bioRxiv Science⌕ Search

bioRxiv · 10.64898/2026.05.20.726726

Cohort-stratified prioritization of CRISPR-Cas9 sgRNAs for HDR-mediated correction of TP53 hotspot codons in cancer

Abstract

TP53 is mutated in roughly half of all human cancers. Eight recurrent missense substitutions in the DNA-binding domain (R175H, Y220C, G245S, R248Q, R248W, R249S, R273H, R282W) account for most of the mutational burden. Homology-directed repair (HDR) with a wild-type donor template is one of the few feasible routes to revert these alleles, but existing CRISPR sgRNA design tools rank candidates without reference to the cancer cohort being treated. We built a reproducible pipeline that prioritizes SpCas9 sgRNAs for HDR-mediated correction of TP53 hotspot codons. The pipeline uses NM 000546.6 from NCBI, GRCh38 off-target search via Cas-OFFinder with the published Doench-2016 CFD matrices, on-target Doench-2016 (Rule Set 2) scores from CRISPOR, and per-cohort hotspot prevalence from three TCGA Pan-Cancer Atlas studies (HGSOC, n = 523; PDAC, n = 179; CRC, n = 534) accessed through cBioPortal. We enumerate guides whose cut sites fall within {+/-}10 nt of each hotspot codon, exclude any candidate that fails to map to GRCh38, and score the remainder. The final set contains 21 SpCas9 NGG sgRNAs across the seven hotspots, with no PAM-desert residues. A single candidate at R248 (TP53-248-P-ad878223; spacer GCATGGGCGGCATGAACCGG, AGG PAM; off-target specificity 0.913 over 806 reference-genome hits) ranks first in all three cohorts and holds rank 1 in 97% of 147 weight settings tested. Four additional residues (R175, Y220, R273, R282) yield within-residue tier-1 picks robust in 100% of weight settings. Cohort-specific differences appear only in cross-residue ordering: R175 and R282 climb in CRC, consistent with the higher prevalence of R175H and R282W in colorectal tumors.

Explore related subjects

Keep this discovery

Explore connections, maps & timelines

BibTeXRIS

Loke, S., Movva, N. S. V., Hota, M.. 2026-05-22. Cohort-stratified prioritization of CRISPR-Cas9 sgRNAs for HDR-mediated correction of TP53 hotspot codons in cancer. https://doi.org/10.64898/2026.05.20.726726

Cite the original work for its findings. Save a collection to share your selection of sources.

KEEP EXPLORING

Related preprints

AF3 Inspector: In-Browser 3D Model Visualization and Confidence Analytics for AlphaFold 3

AlphaFold 3 (AF3) has broadened the computational structural biology landscape by predicting all-atom complexes across proteins, nucleic acids, small-molecule ligands, and ions, including chemical modifications. For non-experts, Google provides a fully web-based service to utilize AlphaFold 3. Unfortunately, despite a flexible and rich interface for inputs, the server's outputs are incomplete and complicated for many users, as witnessed hands-on. Not all confidence metrics are displayed, and those that are shown do not present much interactivity; besides, only model number 1 is shown among the 5 produced by the software, and upon download the user finds the models are provided only in CIF format, which is not yet well-known especially among highly practical users. Here, we present the AlphaFold 3 Multi-Model Inspector (AF3 Inspector, https://pdbms.altervista.org/af3viewer/afviewer8.html), an open, client-side, zero-install web application designed to dissect, align, and interactively explore the complete ensemble of structural models produced by AlphaFold 3. Part of the PDB Manipulation Suite (https://pdbms.altervista.org/), the AF3 Inspector operates entirely within web browsers, meaning it is available out of the box in all devices and operating systems. AF3 Inspector delivers 3D visualization in various styles and colors for all models, overlay with backbone alignment if requested, interactive plots for pLDDT profiles, pAE matrices and contact maps, chain-pair interaction heatmaps, automated detection of ligands, ions and post-translational modifications, and rapid mmCIF-to-PDB conversion allowing users to download the more familiar files. The platform addresses critical practical considerations highlighted in recent community benchmarks, such as CASP16, and extends the lightweight, client-side biophysical toolkit paradigm established by the PDB Manipulation Suite (PDBMS).

bioinformatics↗

PanVasc Research for AI assisted evidence analysis in panvascular intervention

Panvascular intervention research requires evidence workflows that preserve source identity, outcome definitions and observation windows. We developed PanVasc Research, an executable research framework, and evaluated a fixed local Qwen3-4B model using two complementary tasks. Fifty ClinicalTrials.gov records from five vascular query strata generated 200 source-fidelity tests with intact evidence or controlled removal of the requested source, primary outcome or timeframe, plus 50 clean controls. A separate 100-statement sample from the official NLI4CT test set assessed clinical-trial entailment and evidence selection against existing expert labels. Generic and checklist prompts used identical evidence and maximum generation budgets; each output was also evaluated with an input-only deterministic contract. Registry exact accuracy was 51/200 (25.5%) with the generic prompt and 77/200 (38.5%) with the checklist; intact-case agreement was 50/50 and 48/50. The rule baseline recovered 200/200 tuples. NLI label accuracy was 48/100 (48.0%) and 50/100 (50.0%), respectively. The source contract retained 35 and 31 incorrect NLI labels in the two arms. Registry references establish fidelity to a registration snapshot, while NLI4CT concerns breast-cancer trials and does not validate vascular expertise. The framework also retains provenance-recorded literature retrieval, structured research planning and local numerical analysis. These experiments support a bounded assessment of source handling and semantic failure, rather than a new foundation model or autonomous scientific discovery. A proposed endpoint representation identifies the additional domain annotation and independent validation required for a panvascular research model.

bioinformatics↗

BiomiX 3.0: A user-friendly platform for democratized multi-omics integration with graph-based learning.

Background Multi-omics integration has emerged as a powerful strategy to decode the molecular complexity of biological systems. However, the diversity of available methods, each designed with distinct assumptions, objectives, and computational requirements, makes method selection, usage and interpretation challenging for nonexpert users. Here we present BiomiX 3.0, an updated version of the BiomiX platform that extends its integration capabilities with four additional methods: Similarity Network Fusion (SNF), NEighborhood-based Multi-Omics clustering (NEMO), Data Integration Analysis for Biomarker discovery using Latent variable approaches for Omics studies (DIABLO), and PRAMIGO (Phenotyping netwoRk Application for Multi-omics InteGratiOn), a novel supervised heterogeneous graph transformer (HGT) introduced in this work. Results We benchmarked all five methods, MOFA, DIABLO, SNF, NEMO, and PRAMIGO, on two independent multiomics datasets derived from a Chronic Lymphocytic Leukemia (CLL) cohort comparing IGHV-mutated and unmutated patients, and a pulmonary tuberculosis (PTB) cohort versus healthy controls. Supervised methods (DIABLO, PRAMIGO) consistently achieved higher condition-specific discrimination as measured by the Adjusted Rand Index (ARI) and the Adjusted Mutual Information (AMI). In contrast, unsupervised methods (SNF, NEMO) revealed alternative patient stratifications driven by independent sources of biological variance while MOFA performed in a semi-supervised way occupies an intermediate position, capturing latent factors that explain both disease-associated and orthogonal sources of variance. Systematic gene-centric analysis of the top-ranked features prioritized by each method was supported by manual biological annotation of shared and method-specific signals. Across cohorts, we annotated 154 shared features (116 genes, 38 metabolites) and 60 method-unique features per cohort, demonstrating that no single integration strategy captures the full landscape of biologically relevant signals. In the CLL cohort, shared features spanned B-cell receptor biology, innate immune signaling, RAS/MAPK activation, and epigenetic regulation, while methodunique features revealed supervised-method-specific insights into vesicle trafficking (DIABLO), immune checkpoints (MOFA), and ncRNA regulation (PRAMIGO). In the PTB cohort, a convergent interferon/innate immune signature dominated shared features across all methods. Still, method-unique analysis uncovered DIABLO-specific acylcarnitine metabolic reprogramming, MOFA-specific restoration of lysosomal trafficking, and PRAMIGO-specific {gamma}{delta} T-cell and immunoglobulin repertoire diversity. Across both cohorts, SNF and NEMO proved useful for detecting biological and technical sources of variation that were orthogonal to the primary condition of interest. Ultimately, PRAMIGO uniquely enables the construction of heterogeneous graphs modeling cross-modal molecular interactions, uncovering epigenetic co-regulation programs in CLL and multi-omics inflammatory modules in PTB that are difficult to identify using conventional integration approaches. Conclusions BiomiX 3.0 provides a graphical user interface (GUI) multi-method integration environment that democratizes access to state-of-the-art multi-omics analysis. By combining both unsupervised and supervised integration strategies within a unified platform and introducing graph-based learning through PRAMIGO, BiomiX 3.0 enables researchers across disciplines with complementary tools to interrogate the biological sources of variation in their data, without requiring bioinformatics expertise.

bioinformatics↗