Biology subjects

Hota, M.

Publications and source records attributed to Hota, M..

2 recordsLinked to original sources

bioRxiv2026

Cohort-stratified prioritization of CRISPR-Cas9 sgRNAs for HDR-mediated correction of TP53 hotspot codons in cancer

TP53 is mutated in roughly half of all human cancers. Eight recurrent missense substitutions in the DNA-binding domain (R175H, Y220C, G245S, R248Q, R248W, R249S, R273H, R282W) account for most of the mutational burden. Homology-directed repair (HDR) with a wild-type donor template is one of the few feasible routes to revert these alleles, but existing CRISPR sgRNA design tools rank candidates without reference to the cancer cohort being treated. We built a reproducible pipeline that prioritizes SpCas9 sgRNAs for HDR-mediated correction of TP53 hotspot codons. The pipeline uses NM 000546.6 from NCBI, GRCh38 off-target search via Cas-OFFinder with the published Doench-2016 CFD matrices, on-target Doench-2016 (Rule Set 2) scores from CRISPOR, and per-cohort hotspot prevalence from three TCGA Pan-Cancer Atlas studies (HGSOC, n = 523; PDAC, n = 179; CRC, n = 534) accessed through cBioPortal. We enumerate guides whose cut sites fall within {+/-}10 nt of each hotspot codon, exclude any candidate that fails to map to GRCh38, and score the remainder. The final set contains 21 SpCas9 NGG sgRNAs across the seven hotspots, with no PAM-desert residues. A single candidate at R248 (TP53-248-P-ad878223; spacer GCATGGGCGGCATGAACCGG, AGG PAM; off-target specificity 0.913 over 806 reference-genome hits) ranks first in all three cohorts and holds rank 1 in 97% of 147 weight settings tested. Four additional residues (R175, Y220, R273, R282) yield within-residue tier-1 picks robust in 100% of weight settings. Cohort-specific differences appear only in cross-residue ordering: R175 and R282 climb in CRC, consistent with the higher prevalence of R175H and R282W in colorectal tumors.

bioinformatics↗

bioRxiv2022

Semaphorin3F reduces vascular endothelial and smooth muscle cell PI3K activation and decreases neointimal plaque formation

We previously conducted genetic analyses, and identified semaphorin signaling as associating with coronary artery disease. Of the semaphorins, human vascular expression profiling suggested SEMA3F as potentially linked to atherogenesis. In hyperlipidemic mice, SEMA3F reduced aortic lesion area, and increased fibrous cap endothelial content, leading to plaque stability. In a disturbed-flow-mediated endothelial dysfunction-driven lesion model, the absence of Sema3f increased plaques, further implicating SEMA3F in endothelial function. Monocyte adhesion to Sema3f-/- vascular endothelial cells (VECs) was elevated, driven by increased PI3K activity, leading to increased NF-{kappa}B-mediated elevation in VCAM1 and ICAM1 expression, suggesting that SEMA3F reduces VEC PI3K activity. Increased permeability led to increased monocyte transmigration through Sema3f-/- VECs, and mTOR phosphorylation was decreased, suppressing VE-cadherin expression and cell-cell adherens junction stability. Actomyosin fiber formation was decreased in Sema3f-/- VECs, which was reversed by PI3K inhibition, further implicating SEMA3F in adherens junction stability. In Sema3f-/- vascular smooth muscle cells (VSMCs), active PI3K was also increased. PI3K facilitates VSMC proliferation, migration, and pro-atherogenic phenotype switching, which were reduced by SEMA3F. In agreement, in a model of VSMC proliferation and migration-induced neointima formation, SEMA3F reduced plaques. Semaphorin3F is causally atheroprotective. SEMA3Fs suppression of VEC and VSMC PI3K activation may contribute to its atheroprotection.

physiology↗