Biology subjects

Yu, D.

Publications and source records attributed to Yu, D..

171 records · Page 10Linked to original sources

bioRxiv2018

Electromechanics and Volume Dynamics in Non-excitable Tissue Cells

Cell volume regulation is fundamentally important in phenomena such as cell growth, proliferation, tissue homeostasis and embryogenesis. How the cell size is set, maintained, and changed over a cells lifetime is not well understood. In this work we focus on how the volume of non-excitable tissue cells is coupled to the cell membrane electrical potential and the concentration of membrane-permeable ions in the cell environment. Specifically, we demonstrate that a sudden cell depolarization using the whole cell patch clamp results in a 30 percent increase in cell volume, while hyperpolarization results in a slight volume decrease. We find that cell volume can be partially controlled by changing the chloride or the sodium/potassium concentrations in the extracellular environment while maintaining a constant external osmotic pressure. Depletion of external chloride leads to a volume decrease in suspended HN31 cells. Introducing cells to a high potassium solution causes volume increase by up to 50%. Cell volume is also influenced by cortical tension: actin depolymerization leads to cell volume increase. We present an electrophysiology model of water dynamics driven by changes in membrane potential and in the concentration of permeable ions in the cell surrounding. The model quantitatively predicts that the cell volume is determined by the total amount of intracellular ion and protein content.

biophysics↗

bioRxiv2018

NormExpression: an R package to normalize gene expression data using evaluated methods

Data normalization is a crucial step in the gene expression analysis as it ensures the validity of its downstream analyses. Although many metrics have been designed to evaluate the current normalization methods, the different metrics yield inconsistent results. In this study, we designed a new metric named Area Under normalized CV threshold Curve (AUCVC) and applied it with another metric mSCC to evaluate 14 commonly used normalization methods, achieving consistency in our evaluation results using both bulk RNA-seq and scRNA-seq data from the same library construction protocol. This consistency has validated the underlying theory that a sucessiful normalization method simultaneously maximizes the number of uniform genes and minimizes the correlation between the expression profiles of gene pairs. This consistency can also be used to analyze the quality of gene expression data. The gene expression data, normalization methods and evaluation metrics used in this study have been included in an R package named NormExpression. NormExpression provides a framework and a fast and simple way for researchers to evaluate methods (particularly some data-driven methods or their own methods) and then select a best one for data normalization in the gene expression analysis.

bioinformatics↗

bioRxiv2017

Examination of the Shared Genetic Basis of Anorexia Nervosa and Obsessive-Compulsive Disorder

Anorexia nervosa (AN) and obsessive-compulsive disorder (OCD) are often comorbid and likely to share genetic risk factors. Hence, we examine their shared genetic background using a crossdisorder GWAS meta-analysis of 3,495 AN cases, 2,688 OCD cases and 18,013 controls. We confirmed a high genetic correlation between AN and OCD (rg = 0.49 {+/-} 0.13, p = 9.07x10-7) and a sizable SNP heritability (SNP h2 = 0.21 {+/-} 0.02) for the cross-disorder phenotype. Although no individual loci reached genome-wide significance, the cross-disorder phenotype showed strong positive genetic correlations with other psychiatric phenotypes (e.g., bipolar disorder, schizophrenia, neuroticism) and negative correlations with metabolic phenotypes (e.g., BMI, triglycerides). Follow-up analyses revealed that although AN and OCD overlap heavily in their shared risk with other psychiatric phenotypes, the relationship with metabolic and anthropometric traits is markedly stronger for AN than for OCD. We further tested whether shared genetic risk for AN/OCD was associated with particular tissue or cell-type gene expression patterns and found that the basal ganglia and medium spiny neurons were most enriched for AN/OCD risk, consistent with neurobiological findings for both disorders. Our results confirm and extend genetic epidemiological findings of shared risk between AN and OCD and suggest that larger GWASs are warranted.

genetics↗

bioRxiv2017

Sex differences in the genetic architecture of obsessive-compulsive disorder

Obsessive-compulsive disorder (OCD), a highly heritable complex phenotype, demonstrates sexual dimorphism in age of onset and clinical presentation, suggesting a possible sex difference in underlying genetic architecture. We present the first genome-wide characterization of the sex-specific genetic architecture of OCD, utilizing the largest set of OCD cases and controls available from the Psychiatric Genomics Consortium. We assessed evidence for several mechanisms that may contribute to sexual-dimorphism including a sexually dimorphic liability threshold, the presence of individual sex-specific risk variants on the autosomes and the X chromosome, genetic and phenotypic heterogeneity, and sex-specific pleiotropic effects. We observed a strong genetic correlation between male and female OCD and no evidence for a sexually dimorphic liability threshold model. While we did not detect any sex-specific genome-wide associations, we observed that the SNPs with sexually dimorphic effects showed an enrichment of regulatory variants influencing expression of genes in immune tissues. Furthermore, top sex-specific genome-wide associations were enriched for regulatory variants in different tissues, suggesting evidence for potential sex difference in the biology underlying risk for OCD. These findings suggest that future studies with larger sample sizes hold great promise for the identification of sex-specific risk factors for OCD, significantly advancing our understanding of the differences in the genetic basis of sexually dimorphic neuropsychiatric traits.

genomics↗

bioRxiv2017

Smad9 is a key player of follicular selection in goose via keeping the balance of LHR transcription

The egg production of poultry depends on follicular development and selection. However, the mechanism of selecting the priority of hierarchical follicles is completely unknown. Smad9 is one of the important transcription factors in BMP/Smads pathway and involved in goose follicular initiation. To explore its potential role in goose follicle hierarchy determination, we first blocked Smad9 expression using BMP typereceptor inhibitor LDN-193189 both in vivo and in vitro. Unexpectedly, LDN-193189 administration could dramatically suppress Smad9 level and elevate egg production (7.08 eggs / bird, P< 0.05) of animals, and the estradiol (E2) and luteinizing hormone receptor (LHR) level were significantly increased (P< 0.05), but the progesterone (P4) and follicle stimulating hormone receptor (FSHR) mRNA remain unchanged. Surprisingly, Smad9 knockdown notably attenuated (P< 0.05) in E2, P4, FSHR and LHR level in goose granulosa cells (gGCs). Further chromatin immunoprecipitation (ChIP) assay of gGCs revealed that Smad9, served as a sensor of balance, bound to the LHR promoter regulating its transcription. These findings demonstrated that Smad9 is differentially expressed in goose follicles, and acts as a key player in controlling goose follicular selection.\n\nSUMMARY STATEMENTTo study the hierarchical development mechanism of avian follicle, new strategies can be found to improve the egg production of low-yielding poultry, such as geese.

developmental biology↗

bioRxiv2017

The Early Diagnosis in Lung Cancer by the Detection of Circulating Tumor DNA

BackgroundRemarkable advances for clinical diagnosis and treatment in cancers including lung cancer involve cell-free circulating tumor DNA (ctDNA) detection through next generation sequencing. However, before the sensitivity and specificity of ctDNA detection can be widely recognized, the consistency of mutations in tumor tissue and ctDNA should be evaluated. The urgency of this consistency is extremely obvious in lung cancer to which great attention has been paid to in liquid biopsy field.\n\nMethodsWe have developed an approach named systematic error correction sequencing (Sec-Seq) to improve the evaluation of sequence alterations in circulating cell-free DNA. Averagely 10 ml preoperative blood samples were collected from 30 patients containing pulmonary space occupying pathological changes by traditional clinic diagnosis. cfDNA from plasma, genomic DNA from white blood cells, and genomic DNA from solid tumor of above patients were extracted and constructed as libraries for each sample before subjected to sequencing by a panel contains 50 cancer-associated genes encompassing 29 kb by custom probe hybridization capture with average depth >40000, 7000, or 6300 folds respectively.\n\nResultsDetection limit for mutant allele frequency in our study was 0.1%. The sequencing results were analyzed by bioinformatic expertise based on our previous studies on the baseline mutation profiling of circulating cell-free DNA and the clinicopathological data of these patients. Among all the lung cancer patients, 78% patients were predicted as positive by ctDNA sequencing when the shreshold was defined as at least one of the hotspot mutations detected in the blood (ctDNA) was also detected in tumor tissue. Pneumonia and pulmonary tuberculosis were detected as negative according to the above standard. When evaluating all hotspots in driver genes in the panel, 24% mutations detected in tumor tissue (tDNA) were also detected in patients blood (ctDNA). When evaluating all genetic variations in the panel, including all the driver genes and passenger genes, 28% detected in tumor tissue (tDNA) were also detected in patients blood (ctDNA). Positive detection rates of plasma ctDNA in stage I lung cancer patients is 85%, compared with 17% of tumor biomarkers.\n\nConclusionWe demonstrated the importance of sequencing both circulating cell-free DNA and genomic DNA in tumor tissue for ctDNA detection in lung cancer currently. We also determined and confirmed the consistency of ctDNA and tumor tissue through NGS according to the criteria explored in our studies. Our strategy can initially distinguish the lung cancer from benign lesions of lung. Our work shows that the consistency will be benefited from the optimization in sensitivity and specificity in ctDNA detection.

cancer biology↗

bioRxiv2017

Complemented palindrome small RNAs first discovered from SARS coronavirus

In this study, we reported for the first time the existence of complemented palindrome small RNAs (cpsRNAs) and proposed cpsRNAs and palindrome small RNAs (psRNAs) as a novel class of small RNAs. The first discovered cpsRNA UCUUUAACAAGCUUGUUAAAGA from SARS coronavirus named SARS-CoV-cpsR-22 contained 22 nucleotides perfectly matching its reverse complementary sequence. Further sequence analysis supported that SARS-CoV-cpsR-22 originated from bat betacoronavirus. The results of RNAi experiments showed that one 19-nt segment of SARS-CoV-cpsR-22 significantly induced cell apoptosis. These results suggested that SARS-CoV-cpsR-22 could play a role in SARS-CoV infection or pathogenicity. The discovery of psRNAs and cpsRNAs paved the way to find new markers for pathogen detection and reveal the mechanisms in the infection or pathogenicity from a different point of view. The discovery of psRNAs and cpsRNAs also broaden the understanding of palindrome motifs in animal of plant genomes.

genomics↗

bioRxiv2017

Carrion Fly-Derived DNA Metabarcoding Is An Effective Tool For Mammal Surveys: Evidence From A Known Tropical Mammal Community

Metabarcoding of vertebrate DNA derived from carrion flies has been proposed as a promising tool for biodiversity monitoring. To evaluate its efficacy, we conducted metabarcoding surveys of carrion flies on Barro Colorado Island (BCI), Panama, which has a well-known mammal community, and compared our results against diurnal transect counts and camera-trapping. We collected 1084 flies in 29 sampling days, which were pooled into 102 DNA extractions. We then conducted metabarcoding with mammal-specific (16S) and vertebrate-specific (12S) primers targeting mtDNA, and sequenced these amplicons on Illumina MiSeq. For taxonomic assignment, we compared BLAST with the new program PROTAX, and we found PROTAX significantly improved species identifications. We detected 20 mammal, four bird, and one lizard species from carrion fly metabarcoding, all but one of which were previously known from BCI. Fly metabarcoding detected more mammal species than concurrent transect counts (29 sampling days, 13 species) and concurrent camera-trapping (84 sampling days, 17 species), and detected 67% of the number of mammal species documented by 8 years of transect counts and camera-trapping combined, although fly metabarcoding missed several abundant species. This study demonstrates that carrion fly metabarcoding is a powerful tool for mammal biodiversity surveys, and has the potential to detect a broader range of species than more commonly used methods.

zoology↗

bioRxiv2017

Nucleotide-Driven Triple-State Remodeling Of The AAA-ATPase Channel In The Activated Human 26S Proteasome

The proteasome is a sophisticated ATP-dependent molecular machine responsible for protein degradation in all eukaryotic cells. It remains elusive how conformational changes of the AAA-ATPase unfoldase in the regulatory particle (RP) control the gating of substrate-translocation channel to the proteolytic chamber of the core particle (CP). Here we report three alternative states of the ATP-{gamma}S-bound human proteasome, in which the CP gate is asymmetrically open, visualized by cryo-EM at near-atomic resolutions. Only four nucleotides are stably bound to the AAA-ATPase ring in the open-gate states. Concerted nucleotide exchange gives rise to a back-and-forth wobbling motion of the AAA-ATPase channel, coincident with remarkable transitions of their pore loops between the spiral staircase and saddle-shaped circle topologies. Gate opening in the CP is thus controlled with nucleotide-driven remodeling of the AAA-ATPase unfoldase. These findings demonstrate an elegant mechanism of allosteric coordination among sub-machines within the holoenzyme that is crucial for substrate translocation.

biochemistry↗