Biology subjects

Yu, D.

Publications and source records attributed to Yu, D..

18 recordsLinked to original sources

bioRxiv2018

The biodiversity benefit of native forest over Grain-for-Green plantations

AimChinas Grain-for-Green Program (GFGP) is the largest reforestation program in the world and has been operating since 1999. The GFGP has promoted the establishment of tree plantations over the preservation of diverse native forest. In a previous study (Hua et al. 2016, Nat Comms 7:12717), we showed that native forest supports higher species richnesses of birds and bees than do GFGP plantations. We also showed that mixed-plantation GFGP plantations, which are mostly made up of two to five neighboring monoculture stands of different tree species, planted in checkboard fashion, support a level of bird (but not bee) species richness that is higher than any of the individual GFGP monocultures, although still below that of native forest. To better protect terrestrial biodiversity, which is an important objective of Chinas land-sustainability spending, we recommended that the GFGP should firstly prioritize native forest conservation and regeneration and secondly promote checkerboard planting arrangements over monocultures. Here, we use metabarcoding of arthropod biodiversity to test the generality of these results and policy recommendations.\n\nLocationSichuan, China\n\nMethodsWe used COI-amplicon sequencing ( metabarcoding) of bulk samples of arthropods that were collected with pan traps in native forest, cropland, mixed plantations, and monocultures.\n\nResultsNative forest supports the highest overall levels of arthropod species richness and diversity, followed by cropland and mixed plantations, followed by bamboo monoculture, followed by the other monocultures. Also, the arthropod community in mixed plantations shares more species with native forest than do any of the monocultures. Together, these results show a biodiversity value of mixed plantations for arthropods that is higher than that previously indicated by bees alone.\n\nMain conclusionThese results strengthen our original policy recommendations of (1) promoting the conservation and expansion of native forest and (2) promoting mixed-plantation arrangements. The value of this added metabarcoding-based analysis is that these policy prescriptions are now also based on a dataset that includes over 500 species-resolution taxa, ranging across the Arthropoda.

ecology↗

bioRxiv2018

Novel Data Transformations for RNA-seq Data Analysis

We propose eight data transformations for RNA-seq data analysis aiming to make the transformed sample mean to be representative of the distribution center since it is not always possible to transform count data to satisfy the normality assumption. Simulation studies showed that limma based on transformed data by using the rv transformation (denoted as limma+rv) performed best compared with limma based on transformed data by using other transformation methods in term of high accuracy and low FNR, while keeping FDR at the nominal level. For large sample size, limma based on transformed data by using the 8 proposed transformation methods had similar performance to limma based on transformed data by using existing transformation methods for equal library size scenarios. Otherwise, limma based on transformed data by using the rv, lv, rv2, or lv2 transformation, or by using the existing voom transformation performed better than limma based on data from other transformation methods. Real data analysis results showed that limma+ l2 performed best, while limma+ rv also had good performance.

bioinformatics↗

bioRxiv2018

GWAS using 2b-RAD sequencing identified three mastitis important SNPs via two-stage association analysis in Chinese Holstein cows.

BackgroundBovine mastitis is a key disease restricting developing global dairy industry. Genomic wide association studies (GWAS) provided a convenient way to understand the biological basis of mastitis and better prevent or treat the disease. 2b-RADseq is a reduced-representation sequencing that offered a powerful method for genome-wide genetic marker development and genotyping. This study, GWAS using two-stage association analysis identified mastitis important genes single nucleotide polymorphisms (SNP) in Chinese Holstein cows.\n\nResultsIn the selected Chinese Holstein cows population, we identified 10,058 SNPs and predicted their allele frequencies. In stage I, 42 significant SNPs screened out in Chinese Holstein cows via Bayesian (P<0.001), while logistic regression model identified 51 SNPs (P<0.01). Twenty-seven significant SNPs appeared simultaneously in both analytical models, which of them only three significant SNPs (rs75762330, C>T, PIC=0.2999; rs88640083, A>G, PIC=0.1676; rs20438858, G>A, PIC=0.3366) located in non-coding region (introns and intergenic) screened out associated with inflammation or immune response. GO enrichment analysis showed that they annotated to three genes (PTK2B, SYK and TNFRSF21), respectively. Stage II? case-control study used to verify three important SNPs associated with dairy cows mastitis traits in independent population. Data suggested that the correlation between these three SNPs (rs75762330, P<0.025; rs88640083, P<0.005; rs20438858, P<0.001) and mastitis traits in dairy cows were consistent with stage I.\n\nConclusionTwo-stage association analysis approved that three significant SNPs associated with mastitis traits in Chinese Holstein cows. Gene function analysis indicated that three genes (PTK2B, SYK and TNFRSF21) involved in inflammation and immune response of dairy cows. Suggesting that they as new candidate genes have an impact on mastitis susceptibility (PTK2B and SYK, OR>1) or resistance (TNFRSF21, OR<1) in Chinese Holstein cows.

genomics↗

bioRxiv2018

New Statistical Methods for Constructing Robust Differential Correlation Networks

The interplay among microRNAs (miRNAs) plays an important role in the developments of complex human diseases. Co-expression networks can characterize the interactions among miRNAs. Differential correlation network is a powerful tool to investigate the differences of co-expression networks between cases and controls. To construct a differential correlation network, the Fishers Z-transformation test is usually used. However, the Fishers Z-transformation test requires the normality assumption, the violation of which would result in inflated Type I error rate. Several bootstrapping-based improvements for Fishers Z test have been proposed. However, these methods are too computationally intensive to be used to construct differential correlation networks for high-throughput genomic data. In this article, we proposed six novel robust equal-correlation tests that are computationally efficient. The systematic simulation studies and a real microRNA data analysis showed that one of the six proposed tests (ST5) overall performed better than other methods.

bioinformatics↗

bioRxiv2018

Experimental demonstration that screening can enable the environmental recruitment of a defensive microbiome

Many animals and plants recruit beneficial microbes from the environment, enhancing their defence against pathogens. However, we have only a limited understanding of the assembly mechanisms involved. A game-theoretical concept from economics, screening, potentially explains how a host selectively recruits mutualistic microbes from the environment by fomenting and biasing competition among potential symbionts in such a way that the more likely winners are antibiotic producers. The cuticular microbiomes of Acromyrmex leaf-cutting ants inspired one of the first applications of screening theory, and here we simulate this system in vitro to test screening. On agar infused with antibacterial metabolites from Acromyrmexs vertically transmitted Pseudonocardia bacteria, we show that antibiotic-producing Streptomyces bacteria exhibit higher growth rates than do non-antibiotic-producer strains and are more likely to win in direct competition. Our results demonstrate how game-theoretical concepts can provide powerful insight into host-microbiome coevolution.

evolutionary biology↗

bioRxiv2018

Insight into relationship between micro-consortia, nitrogen source and petroleum degradation at low temperature anaerobic condition

Biostimulation by addition nutrients has been proved to be an effective bioremediation strategies. Revealing response law of nitrogen source and structure characteristics of anaerobic petroleum degrading microorganisms microbial population will help us optimize nutrient to promote oil degradation. Anaerobic micro-consortia characteristics in the enrichment marine sediment samples with different nitrogen source, combining with analysis of the oil degradation rates were studied in this paper, as well as functional genes involved in petroleum degradation were also analyzed. On the basis of optimizing the best inorganic nitrogen sources and organic nitrogen sources, an effective medium was designed by response surface methodology that used for enriching petroleum degradation micro-consortia. Amplicon sequencing analysis showed that the population of microorganisms migrated obviously when enriched with different nitrogen sources. With the increase of oil degradation rate, the microbial diversity was significantly decreased, and concentrated on a limited number of genera. The reasonable proportions of GammaProteobacteria, Bacteroidetes and Fusobacteria made the greatest contribution to petroleum degradation. Metagenomic analysis unveiled the mixed nitrogen source promoted the expression of functional genes related to petroleum degradation such as the transfer of succinyl-CoA, synthesis of acetyl CoA and {beta}-oxidation cycle, and was beneficial to degradation of petroleum at low temperature anaerobic condition.\n\nOriginality Significance StatementAddition of nutrients can promote growth of indigenous petroleum degradation-related bacteria and be helpful to the rapid degradation of petroleum. Previous studies accurately characterized aerobic microorganisms on petroleum degradation. However, we still known little about anaerobic microorganisms in marine environment. Most biostimulation methods use inorganic salt as the main nutritional supplement to improve the efficiency of petroleum degradation, but effects of different nitrogen sources on diversity of microorganisms and distribution of functional genes related to petroleum degradation at anaerobic conditions are still unknown. In this research, the effects of nitrogen on petroleum biodegradation, anaerobic microconsortium structure and distribution of genes related to petroleum degradation were unveiled by using amplicon sequencing and metagenomic analysis.

microbiology↗

bioRxiv2018

PRL-1 is required for neuroprotection against olfactory CO2 stimulation in Drosophila

The Mammalian phosphatase of regenerating liver (PRL) family is primarily recognized for its oncogenic properties. Here we found that in Drosophila, loss of prl-1 resulted in CO2-induced brain disorder presented as irreversible wing hold up with enhancement of Ca2+ responses at the neuron synaptic terminals. Overexpression of Prl-1 in the nervous system could rescue the mutant phenotype. We show that Prl-1 is particularly expressed in CO2-responsive neural circuit and the higher brain centers. Ablation of the CO2 olfactory receptor, Gr21a, suppressed the mutant phenotype, suggesting that CO2 acts as a neuropathological substrate in absence of Prl-1. Further studies found that the wing hold up is an obvious consequence upon knockdown of Uex, a magnesium transporter, which directly interacts with Prl-1. Conditional expression of Uex in the nervous system could rescue the phenotype of prl-1 mutants. We demonstrate that Uex acts genetically downstream of Prl-1. Our findings provide important insights into mechanisms of Prl-1 protection against olfactory CO2 stimulation induced brain disorder at the level of detailed neural circuits and functional molecular connections.

neuroscience↗

bioRxiv2018

Transcriptome Profiling Reveals Inhibitory Effect of Down-regulated ZBTB38 gene on the Transcriptional Regulation of Tumor Cells Proliferation

Transcription factor ZBTB38 belongs to the zinc finger protein family and contains the typical BTB domains. Only several predicted BTB domain-containing proteins encoded in the human genome have been functionally characterized. No relevant studies have been reported concerning the effect of down-regulated ZBTB38 gene expression on tumor cells through transcriptome analysis. In the present study, 2,438 differentially expressed genes in ZBTB38-/- SH-SY5Y cells were obtained via high-throughput transcriptome sequencing analysis, 83.5% of which was down-regulated. Furthermore, GO functional clustering and KEGG pathway enrichment analysis of these differentially expressed genes (DEGs) revealed that the knocked-down transcription factor ZBTB38 interacted with p53 and arrested cell cycles to inhibit the proliferation of the tumor cells. Besides, it also significantly down-regulated the expressions of PTEN, a \"molecular switch\" of the PI3K/Akt signaling pathway, and RB1CC1, the key gene for autophagy initiation, and blocked autophagy to accelerate the apoptosis of tumor cells. ZBTB38-/- SH-SY5Y cells were investigated at the whole transcriptome level and key DEGs were screened in the present study for the first time, providing a theoretical foundation for exploring the molecular mechanism of inhibition of tumor cell proliferation and targeted anti-tumor therapies.

genomics↗

bioRxiv2018

Establishment and Application of a duplex real-time qPCR method for detection of Salmonella spp. and Serratia fonticola in imported feedstuffs

Salmonella spp. is a high-risk bacterial pathogen that is monitored in imported animal-derived feedstuffs. Serratia fonticola is the bacterial species most frequently confused with Salmonella spp. in traditional identification methods based on biochemical characteristics, which are time-consuming and labor-intensive, and thus unsuitable for daily inspection and quarantine work. In this study, we established a duplex real-time qPCR method with invA-and gyrB-specific primers and probes corresponding to Salmonella spp. and S. fonticola. The method could simultaneously detect both pathogens in imported feedstuffs, with a minimum limit of detection for Salmonella spp. and S. fonticola of 197 copies/L and 145 copies/L, respectively (correlation coefficient R2 = 0.999 in both cases). The amplification efficiency for Salmonella spp. and S. fonticola was 98.346% and 96.49%, respectively. Detection of clinical samples was consistent with method GB/T 13091-2002, and all 20 artificially contaminated imported feed samples were positively identified. Thus, the developed duplex real-time qPCR assay displays high specificity and sensitivity, and can be used for the rapid and accurate detection of genomic DNA from Salmonella spp. and S. fonticola within hours. This represents a significant improvement in the efficiency of detection of both pathogens in imported feedstuffs.\n\nImportanceImported feedstuffs must be tested for pathogenic Salmonella species that represent a biological hazard. Various non-Salmonella colony-forming species belong to Enterobacteriaceae, and Serratia fonticola forms colonies of similar color and morphology to Salmonella spp., leading to confusion in daily quarantine tests. Traditional methods based on biochemical and serological characteristics are cumbersome and labor-intensive, and unable to fully support current quarantine testing demands. Thus, there is an urgent need to develop a rapid and accurate method for the effective identification of these pathogens. The duplex real-time qPCR method established herein can rapidly identify Salmonella spp. and S. fonticola, and has great potential for application to feed safety and prevention of exterior pathogens.

microbiology↗

bioRxiv2018

Electromechanics and Volume Dynamics in Non-excitable Tissue Cells

Cell volume regulation is fundamentally important in phenomena such as cell growth, proliferation, tissue homeostasis and embryogenesis. How the cell size is set, maintained, and changed over a cells lifetime is not well understood. In this work we focus on how the volume of non-excitable tissue cells is coupled to the cell membrane electrical potential and the concentration of membrane-permeable ions in the cell environment. Specifically, we demonstrate that a sudden cell depolarization using the whole cell patch clamp results in a 30 percent increase in cell volume, while hyperpolarization results in a slight volume decrease. We find that cell volume can be partially controlled by changing the chloride or the sodium/potassium concentrations in the extracellular environment while maintaining a constant external osmotic pressure. Depletion of external chloride leads to a volume decrease in suspended HN31 cells. Introducing cells to a high potassium solution causes volume increase by up to 50%. Cell volume is also influenced by cortical tension: actin depolymerization leads to cell volume increase. We present an electrophysiology model of water dynamics driven by changes in membrane potential and in the concentration of permeable ions in the cell surrounding. The model quantitatively predicts that the cell volume is determined by the total amount of intracellular ion and protein content.

biophysics↗

bioRxiv2018

NormExpression: an R package to normalize gene expression data using evaluated methods

Data normalization is a crucial step in the gene expression analysis as it ensures the validity of its downstream analyses. Although many metrics have been designed to evaluate the current normalization methods, the different metrics yield inconsistent results. In this study, we designed a new metric named Area Under normalized CV threshold Curve (AUCVC) and applied it with another metric mSCC to evaluate 14 commonly used normalization methods, achieving consistency in our evaluation results using both bulk RNA-seq and scRNA-seq data from the same library construction protocol. This consistency has validated the underlying theory that a sucessiful normalization method simultaneously maximizes the number of uniform genes and minimizes the correlation between the expression profiles of gene pairs. This consistency can also be used to analyze the quality of gene expression data. The gene expression data, normalization methods and evaluation metrics used in this study have been included in an R package named NormExpression. NormExpression provides a framework and a fast and simple way for researchers to evaluate methods (particularly some data-driven methods or their own methods) and then select a best one for data normalization in the gene expression analysis.

bioinformatics↗

bioRxiv2017

Examination of the Shared Genetic Basis of Anorexia Nervosa and Obsessive-Compulsive Disorder

Anorexia nervosa (AN) and obsessive-compulsive disorder (OCD) are often comorbid and likely to share genetic risk factors. Hence, we examine their shared genetic background using a crossdisorder GWAS meta-analysis of 3,495 AN cases, 2,688 OCD cases and 18,013 controls. We confirmed a high genetic correlation between AN and OCD (rg = 0.49 {+/-} 0.13, p = 9.07x10-7) and a sizable SNP heritability (SNP h2 = 0.21 {+/-} 0.02) for the cross-disorder phenotype. Although no individual loci reached genome-wide significance, the cross-disorder phenotype showed strong positive genetic correlations with other psychiatric phenotypes (e.g., bipolar disorder, schizophrenia, neuroticism) and negative correlations with metabolic phenotypes (e.g., BMI, triglycerides). Follow-up analyses revealed that although AN and OCD overlap heavily in their shared risk with other psychiatric phenotypes, the relationship with metabolic and anthropometric traits is markedly stronger for AN than for OCD. We further tested whether shared genetic risk for AN/OCD was associated with particular tissue or cell-type gene expression patterns and found that the basal ganglia and medium spiny neurons were most enriched for AN/OCD risk, consistent with neurobiological findings for both disorders. Our results confirm and extend genetic epidemiological findings of shared risk between AN and OCD and suggest that larger GWASs are warranted.

genetics↗

bioRxiv2017

Sex differences in the genetic architecture of obsessive-compulsive disorder

Obsessive-compulsive disorder (OCD), a highly heritable complex phenotype, demonstrates sexual dimorphism in age of onset and clinical presentation, suggesting a possible sex difference in underlying genetic architecture. We present the first genome-wide characterization of the sex-specific genetic architecture of OCD, utilizing the largest set of OCD cases and controls available from the Psychiatric Genomics Consortium. We assessed evidence for several mechanisms that may contribute to sexual-dimorphism including a sexually dimorphic liability threshold, the presence of individual sex-specific risk variants on the autosomes and the X chromosome, genetic and phenotypic heterogeneity, and sex-specific pleiotropic effects. We observed a strong genetic correlation between male and female OCD and no evidence for a sexually dimorphic liability threshold model. While we did not detect any sex-specific genome-wide associations, we observed that the SNPs with sexually dimorphic effects showed an enrichment of regulatory variants influencing expression of genes in immune tissues. Furthermore, top sex-specific genome-wide associations were enriched for regulatory variants in different tissues, suggesting evidence for potential sex difference in the biology underlying risk for OCD. These findings suggest that future studies with larger sample sizes hold great promise for the identification of sex-specific risk factors for OCD, significantly advancing our understanding of the differences in the genetic basis of sexually dimorphic neuropsychiatric traits.

genomics↗

bioRxiv2017

Smad9 is a key player of follicular selection in goose via keeping the balance of LHR transcription

The egg production of poultry depends on follicular development and selection. However, the mechanism of selecting the priority of hierarchical follicles is completely unknown. Smad9 is one of the important transcription factors in BMP/Smads pathway and involved in goose follicular initiation. To explore its potential role in goose follicle hierarchy determination, we first blocked Smad9 expression using BMP typereceptor inhibitor LDN-193189 both in vivo and in vitro. Unexpectedly, LDN-193189 administration could dramatically suppress Smad9 level and elevate egg production (7.08 eggs / bird, P< 0.05) of animals, and the estradiol (E2) and luteinizing hormone receptor (LHR) level were significantly increased (P< 0.05), but the progesterone (P4) and follicle stimulating hormone receptor (FSHR) mRNA remain unchanged. Surprisingly, Smad9 knockdown notably attenuated (P< 0.05) in E2, P4, FSHR and LHR level in goose granulosa cells (gGCs). Further chromatin immunoprecipitation (ChIP) assay of gGCs revealed that Smad9, served as a sensor of balance, bound to the LHR promoter regulating its transcription. These findings demonstrated that Smad9 is differentially expressed in goose follicles, and acts as a key player in controlling goose follicular selection.\n\nSUMMARY STATEMENTTo study the hierarchical development mechanism of avian follicle, new strategies can be found to improve the egg production of low-yielding poultry, such as geese.

developmental biology↗

bioRxiv2017

The Early Diagnosis in Lung Cancer by the Detection of Circulating Tumor DNA

BackgroundRemarkable advances for clinical diagnosis and treatment in cancers including lung cancer involve cell-free circulating tumor DNA (ctDNA) detection through next generation sequencing. However, before the sensitivity and specificity of ctDNA detection can be widely recognized, the consistency of mutations in tumor tissue and ctDNA should be evaluated. The urgency of this consistency is extremely obvious in lung cancer to which great attention has been paid to in liquid biopsy field.\n\nMethodsWe have developed an approach named systematic error correction sequencing (Sec-Seq) to improve the evaluation of sequence alterations in circulating cell-free DNA. Averagely 10 ml preoperative blood samples were collected from 30 patients containing pulmonary space occupying pathological changes by traditional clinic diagnosis. cfDNA from plasma, genomic DNA from white blood cells, and genomic DNA from solid tumor of above patients were extracted and constructed as libraries for each sample before subjected to sequencing by a panel contains 50 cancer-associated genes encompassing 29 kb by custom probe hybridization capture with average depth >40000, 7000, or 6300 folds respectively.\n\nResultsDetection limit for mutant allele frequency in our study was 0.1%. The sequencing results were analyzed by bioinformatic expertise based on our previous studies on the baseline mutation profiling of circulating cell-free DNA and the clinicopathological data of these patients. Among all the lung cancer patients, 78% patients were predicted as positive by ctDNA sequencing when the shreshold was defined as at least one of the hotspot mutations detected in the blood (ctDNA) was also detected in tumor tissue. Pneumonia and pulmonary tuberculosis were detected as negative according to the above standard. When evaluating all hotspots in driver genes in the panel, 24% mutations detected in tumor tissue (tDNA) were also detected in patients blood (ctDNA). When evaluating all genetic variations in the panel, including all the driver genes and passenger genes, 28% detected in tumor tissue (tDNA) were also detected in patients blood (ctDNA). Positive detection rates of plasma ctDNA in stage I lung cancer patients is 85%, compared with 17% of tumor biomarkers.\n\nConclusionWe demonstrated the importance of sequencing both circulating cell-free DNA and genomic DNA in tumor tissue for ctDNA detection in lung cancer currently. We also determined and confirmed the consistency of ctDNA and tumor tissue through NGS according to the criteria explored in our studies. Our strategy can initially distinguish the lung cancer from benign lesions of lung. Our work shows that the consistency will be benefited from the optimization in sensitivity and specificity in ctDNA detection.

cancer biology↗

bioRxiv2017

Complemented palindrome small RNAs first discovered from SARS coronavirus

In this study, we reported for the first time the existence of complemented palindrome small RNAs (cpsRNAs) and proposed cpsRNAs and palindrome small RNAs (psRNAs) as a novel class of small RNAs. The first discovered cpsRNA UCUUUAACAAGCUUGUUAAAGA from SARS coronavirus named SARS-CoV-cpsR-22 contained 22 nucleotides perfectly matching its reverse complementary sequence. Further sequence analysis supported that SARS-CoV-cpsR-22 originated from bat betacoronavirus. The results of RNAi experiments showed that one 19-nt segment of SARS-CoV-cpsR-22 significantly induced cell apoptosis. These results suggested that SARS-CoV-cpsR-22 could play a role in SARS-CoV infection or pathogenicity. The discovery of psRNAs and cpsRNAs paved the way to find new markers for pathogen detection and reveal the mechanisms in the infection or pathogenicity from a different point of view. The discovery of psRNAs and cpsRNAs also broaden the understanding of palindrome motifs in animal of plant genomes.

genomics↗

bioRxiv2017

Carrion Fly-Derived DNA Metabarcoding Is An Effective Tool For Mammal Surveys: Evidence From A Known Tropical Mammal Community

Metabarcoding of vertebrate DNA derived from carrion flies has been proposed as a promising tool for biodiversity monitoring. To evaluate its efficacy, we conducted metabarcoding surveys of carrion flies on Barro Colorado Island (BCI), Panama, which has a well-known mammal community, and compared our results against diurnal transect counts and camera-trapping. We collected 1084 flies in 29 sampling days, which were pooled into 102 DNA extractions. We then conducted metabarcoding with mammal-specific (16S) and vertebrate-specific (12S) primers targeting mtDNA, and sequenced these amplicons on Illumina MiSeq. For taxonomic assignment, we compared BLAST with the new program PROTAX, and we found PROTAX significantly improved species identifications. We detected 20 mammal, four bird, and one lizard species from carrion fly metabarcoding, all but one of which were previously known from BCI. Fly metabarcoding detected more mammal species than concurrent transect counts (29 sampling days, 13 species) and concurrent camera-trapping (84 sampling days, 17 species), and detected 67% of the number of mammal species documented by 8 years of transect counts and camera-trapping combined, although fly metabarcoding missed several abundant species. This study demonstrates that carrion fly metabarcoding is a powerful tool for mammal biodiversity surveys, and has the potential to detect a broader range of species than more commonly used methods.

zoology↗

bioRxiv2017

Nucleotide-Driven Triple-State Remodeling Of The AAA-ATPase Channel In The Activated Human 26S Proteasome

The proteasome is a sophisticated ATP-dependent molecular machine responsible for protein degradation in all eukaryotic cells. It remains elusive how conformational changes of the AAA-ATPase unfoldase in the regulatory particle (RP) control the gating of substrate-translocation channel to the proteolytic chamber of the core particle (CP). Here we report three alternative states of the ATP-{gamma}S-bound human proteasome, in which the CP gate is asymmetrically open, visualized by cryo-EM at near-atomic resolutions. Only four nucleotides are stably bound to the AAA-ATPase ring in the open-gate states. Concerted nucleotide exchange gives rise to a back-and-forth wobbling motion of the AAA-ATPase channel, coincident with remarkable transitions of their pore loops between the spiral staircase and saddle-shaped circle topologies. Gate opening in the CP is thus controlled with nucleotide-driven remodeling of the AAA-ATPase unfoldase. These findings demonstrate an elegant mechanism of allosteric coordination among sub-machines within the holoenzyme that is crucial for substrate translocation.

biochemistry↗