Biology subjects

Shen, W.

Publications and source records attributed to Shen, W..

90 records · Page 5Linked to original sources

bioRxiv2020

Laser capture microdissection-based single-cell RNA sequencing reveals optic nerve crush-related early mRNA alterations in retinal ganglion cells

Retinal ganglion cells (RGC) are the primary cell type injured in a variety of diseases of the optic nerve, and the early changes of RGCs RNA profiling may be important to understand the mechanism of optic nerve injury and axon regeneration. Here we employed the optic nerve crush (ONC) model to explore early mRNA alterations in RGCs using laser capture microdissection (LCM) and single-cell RNA sequencing. We successfully established an optimal LCM protocol using 30 m-thick retinal tissue sections mounted on glass slides and laser pressure catapulting (LPC) to collect RGCs and obtain high-quality RNA for single-cell sequencing. Based on our protocol, we identified 8744 differentially expressed genes that were involved in ONC-related early mRNA alterations in RGCs. Candidate genes included Atf3, Lgals3, LOC102551701, Plaur, Tmem140 and Maml1. The LCM-based single-cell RNA sequencing allowed new insights into the early mRNA changes in RGCs, highlighting new molecules associated with ONC.

neuroscience↗

bioRxiv2020

A single-cell transcriptome atlas during Cashmere goat hair follicle morphogenesis

Cashmere, also known as soft gold, is produced from the secondary hair follicles in Cashmere goats and its therefore of significance to investigate the molecular profiles during Cashmere goat hair follicle development. However, our current understanding of the machinery underlying Cashmere goat hair follicle remains largely unexplored and researches regarding hair follicle development mainly used the mouse as a research model. To provides comprehensively understanding on the cellular heterogeneity and cell lineage cell fate decisions, we performed single-cell RNA sequencing on 19,705 single cells from induction (embryonic day 60), organogenesis (embryonic day 90) and cytodifferentiation (embryonic day 120) stages of fetus Cashmere goat dorsal skin. Unsupervised clustering analysis identified 16 cell clusters and their corresponding cell types were also unprecedentedly characterized. Based on the lineage inference, we revealed detailed molecular landscape along the dermal and epidermal cell lineage developmental pathways. Notably, by cross-species comparasion of single cell data with murine model, we revelaed conserved programs during dermal condensate fate commitment and the heterochrony development of hair follicle development between mouse and Cashmere goat were also discussed here. Our work here delineate unparalleled molecular profiles of different cell populations during Cashmere goat hair follicle morphogenesis and provide a valuable resource for identifying biomarkers during Cashmere goat hair follicle development.

developmental biology↗

bioRxiv2019

Dissecting the initiation of female meiosis in the mouse at single-cell resolution

Germ cell meiosis is one of the most finely orchestrated events during gametogenesis with distinct developmental patterns in males and females. However, in mammals, the molecular mechanisms involved in this process remain not well known. Here, we report detailed transcriptome analyses of cell populations present in the mouse female gonadal ridges (E11.5) and the embryonic ovaries from E12.5 to E14.5 using single cell RNA sequencing (scRNA seq). These periods correspond with the initiation and progression of meiosis throughout the first stage of prophase I. We identified 13 transcriptionally distinct cell populations and 7 transcriptionally distinct germ cell subclusters that correspond to mitotic (3 clusters) and meiotic (4 clusters) germ cells. By comparing the signature gene expression pattern of 4 meiotic germ cell clusters, we found that the 4 cell clusters correspond to different cell status en route to meiosis progression, and therefore, our research here characterized detailed transcriptome dynamics during meiotic prophase I. Reconstructing the progression of meiosis along pseudotime, we identified several new genes and molecular pathways with potential critical roles in the mitosis/meiosis transition and early meiotic progression. Last, the heterogeneity within somatic cell populations was also discussed and different cellular states were identified. Our scRNA seq analysis here represents a new important resource for deciphering the molecular pathways driving meiosis initiation and progression in female germ cells and ovarian somatic cells.

developmental biology↗

bioRxiv2019

Transcriptome Landscape Reveals Underlying Mechanisms of Ovarian Cell Fate Differentiation and Primordial Follicle Assembly

Primordial follicle assembly in mammals occurs at perinatal ages and largely determines the ovarian reserve available to support the reproductive lifespan. The primordial follicle structure is generated by a complex network of interactions between oocytes and ovarian somatic cells that remain poorly understood. In the present research, using single-cell RNA sequencing performed over a time-series on mouse ovaries coupled with several bioinformatics analyses, the complete dynamic genetic programs of germ and granulosa cells from E16.5 to PD3 are reported for the first time. The time frame of analysis comprises the breakdown of germ cell cysts and the assembly of primordial follicles. Confirming the previously reported expression of genes by germ cells and granulosa cells, our analyses identified ten distinct gene clusters associated to germ cells and eight to granulosa cells. Consequently, several new genes expressed at significant levels at each investigated stage were assigned. Building single-cell pseudo temporal trajectories five states and two branch points of fate transition for the germ cells, and three states and one branch point for the granulosa cells were revealed. Moreover, GO and ClueGO term enrichment enabled identifying biological processes, molecular functions and cellular components more represented in germ cells and granulosa cells or common to both cell types at each specific stage. Finally, by SCENIC algorithm, we were able to establish a network of regulons that can be postulated as likely candidates for sustaining germ cell specific transcription programs throughout the investigated period.

developmental biology↗

bioRxiv2019

Satellite Imaging of Global Urbanicity relate to Adolescent Brain Development and Behavior

Urbanicity, the impact of living in urban areas, is among the greatest environmental challenges for mental health. While urbanicity might be distinct in different sociocultural conditions and geographic locations, there are likely to exist common features shared in different areas of the globe. Understanding these common and specific relations of urbanicity with human brain and behavior will enable to assess the impact of urbanicity on mental disorders, especially in childhood and adolescence, where prevention and early interventions are likely to be most effective.\n\nWe constructed from satellite-based remote sensing data a factor for urbanicity that was highly correlated with population density ground data. This factor, UrbanSat was utilized in the Chinese CHIMGEN sample (N=831) and the longitudinal European IMAGEN cohort (N=810) to investigate if exposure to urbanicity during childhood and adolescence is associated with differences in brain structure and function in young adults, and if these changes are linked to behavior.\n\nUrbanicity was found negatively correlated with medial prefrontal cortex volume and positively correlated with cerebellar vermis volume in young adults from both China and Europe. We found an increased correlation of urbanicity with functional network connectivity within- and between- brain networks in Chinese compared to European participants. Urbanicity was highly correlated with a measure of perceiving a situation from the perspective of others, as well as symptoms of depression in both datasets. These correlations were mediated by the structural and functional brain changes observed. Susceptibility to urbanicity was greatest in two developmental windows during mid-childhood and adolescence.\n\nUsing innovative technology, we were able to probe the relationship between urban upbringing with brain change and behavior in different sociocultural conditions and geographic locations. Our findings help to identify shared and distinct determinants of adolescent brain development and mental health in different regions of the world, thus contributing to targeted prevention and early-intervention programs for young people in their unique environment. Our approach may be relevant for public health, policy and urban planning globally.

neuroscience↗

bioRxiv2019

Single-cell transcriptome profiling reveals dermal and epithelium cell fate decisions during embryonic hair follicle development

Characterization of the morphological structure during hair follicle development has been well documented, while the current understanding of the molecular mechanisms involved in follicle development remain limited. Here, using unbiased single-cell RNA sequencing, we analyzed 15,086 single cell transcriptome profiles from E13.5 and E16.5 fetal mice, and newborn mouse (postnatal day 0, P0) dorsal skin cells. Based on t-distributed Stochastic Neighbor Embedding (tSNE) clustering, we identified 14 cell clusters from skin cells and delineated their cell identity gene expression profiles. Pseudotime ordering analysis successfully constructed epithelium/dermal cell lineage differentiation trajectory and revealed sequential activation of key regulons involved during cell fate decisions. Along with this, intercellular communication between different cell populations were inferred based on a priori knowledge of ligand-receptor pairs. Together, our findings here provide a molecular landscape during hair follicle epithelium/dermal cell lineage fate decisions, and more importantly, recapitulate sequential activation of core regulatory transcriptional factors for different cell populations during hair follicle morphogenesis.

developmental biology↗

bioRxiv2019

STXBP5/tomosyn regulates both the small Rho GTPase and the surface expression of AMPA receptors to control the dendritic stability of neurons

Tomosyn, a protein encoded by syntaxin-1-binding protein 5 (STXBP5) gene, has a well-established presynaptic role in the inhibition of neurotransmitter release and the reduction of synaptic transmission by its conical interaction with the soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) machinery. The postsynaptic role of tomosyn in dendritic arborization, spine stability, and trafficking of ionotropic glutamate receptors remains to be elucidated. We used short hairpin RNA (shRNA) to knock down tomosyn in mouse primary neurons to evaluate the postsynaptic cellular function and molecular signaling regulated by tomosyn. Knockdown of tomosyn led to an increase of RhoA GTPase activity accompanied by compromised dendritic arborization, loss of dendritic spines, decreased surface expression of AMPA receptors, and reduced miniature excitatory postsynaptic current (mEPSC) frequency. Inhibiting RhoA signaling was sufficient to rescue the abnormal dendritic morphology and the surface expression of AMPA receptors. The function of tomosyn regulating RhoA is mediated through the N-terminal WD40 motif, where two variants each carrying a single nucleotide mutation in this region, were found in individuals with autism spectrum disorder (ASD). We demonstrated that these variants displayed loss-of-function phenotypes. Unlike the wild-type tomosyn, these two variants failed to restore the reduced dendritic complexity, spine density, as well as decreased surface expression of AMPA receptors in tomosyn knockdown neurons. This study uncovers a critical role of tomosyn, independent of its interaction with the SNARE machinery, in maintaining neuronal function by inhibiting RhoA activity. Further analysis of tomosyn variants also provides a potential mechanism for explaining cellular pathology in ASD.\n\nSignificance StatementThis study unveils a vital role of tomosyn in the maintenance of neuronal morphology, basal synaptic transmission, and AMPA receptor surface expression that is distinct from its presynaptic role. Tomosyn affects dendritic stability and glutamate receptor trafficking via the regulation of the Rho signaling pathway and this interaction is likely independent of the interaction with the dendritic SNARE complex, such as syntaxin-4. The WD40 domain of tomosyn is necessary to conduct the Rho regulation and two autism-associated variants localized at the WD40 domain perturb this function. The current study reveals a novel molecular link between dendritic stability and synaptic function, which could advance a greater understanding of the cellular pathologies involved in neurodevelopmental disorders, such as ASD.

neuroscience↗

bioRxiv2019

Liver X Receptor β Controls Hepatic Stellate Cell Activation via Hedgehog Signaling

Liver X receptors (LXR) and {beta} serve important roles in cholesterol homeostasis, anti-inflammatory processes and the activation of hepatic stellate cells (HSCs). However, the development of therapies for liver fibrosis based on LXR agonists have been hampered due to side-effects such as liver steatosis. In this study, we demonstrated that HSCs expressed high levels of LXR{beta}, but not LXR, and that overexpression of LXR{beta} suppressed fibrosis and HSC activation in a carbon tetrachloride (CCl4)-induced fibrosis mouse model, without resulting in liver steatosis. Furthermore, Hedgehog (Hh)-regulated proteins, markedly increased in the CCl4-affected liver and mainly expressed in activated HSCs, were repressed under conditions of LXR{beta} overexpression. In addition, LXR{beta} knockout led to activation of Hh signaling and triggering of HSC activation, while overexpression of LXR{beta} led to the inhibition of the Hh pathway and suppression of HSC activation. These results suggest that LXR{beta} suppresses the activation mechanism of HSCs by inhibiting Hh signaling. In conclusion, LXR{beta}, by restoring the differentiation of HSCs, may be a promising therapeutic target for liver fibrosis without the adverse side-effects of LXR activation.

cell biology↗

bioRxiv2019

Characterization and repurposing of the endogenous Type I-F CRISPR-Cas system of Zymomonas mobilis for genome engineering

Establishment of production platform organisms through prokaryotic engineering represents an efficient means to generate alternatives for yielding renewable biochemicals and biofuels from sustainable resources. Zymomonas mobilis, a natural facultative anaerobic ethanologen, possesses many attractive physiological attributes, making it an important industrial microorganism. To facilitate the broad applications of this strain for biorefinery, an efficient genome engineering toolkit for Z. mobilis was established in this study by repurposing the endogenous Type I-F CRISPR-Cas system upon its functional characterization, and further updated. This toolkit includes a series of genome engineering plasmids, each carrying an artificial self-targeting CRISPR and a donor DNA for the recovery of recombinants. Using the updated toolkit, genome engineering purposes were achieved with efficiencies of up to 100%, including knockout of cas3 gene, replacement of cas3 with the mCherry-encoding rfp gene, nucleotide substitutions in cas3, and deletion of two large genomic fragments up to 10 kb. This study established thus far the most efficient, straightforward and convenient genome engineering toolkit for Z. mobilis, and laid a foundation for further native CRISPRi studies in Z. mobilis, which extended the application scope of CRISPR-based technologies, and could also be applied to other industrial microorganisms with unexploited endogenous CRISPR-Cas systems.

bioengineering↗

bioRxiv2019

Amplification-free Library Preparation Improves Quality of Hi-C Analysis

PCR amplification of Hi-C libraries introduces unusable duplicates and results in a biased representation of chromatin interactions. We present a simplified, fast, and economically efficient Hi-C library preparation procedure that generates sufficient non-amplified ligation products for deep sequencing from 30 million Drosophila cells. Comprehensive analysis of the resulting data indicates that amplification-free Hi-C preserves higher complexity of chromatin interaction and lowers sequencing depth dramatically for the same number of unique paired reads. For human cells which has a large genome, this method recovers an amount of ligated fragments enough for direct high-throughput sequencing without amplification on as low as 250 thousand of cells. Comparison with published in situ Hi-C on millions of human cells reveals that amplification introduces distance-dependent amplification bias, which results in increasing background noise level against genomic distance. With amplification bias avoided, our method may produce a chromatin interaction network more faithfully reflecting the real three-dimensional genomic architecture.

genomics↗

bioRxiv2019

TaxonKit: a cross-platform and efficient NCBI taxonomy toolkit

SummaryTaxonKit is a command-line toolkit for rapid manipulation of NCBI taxonomy data. It provides executable binary files for major operating systems including Windows, Linux, and Mac OS X, and can be directly used without any dependencies nor local database buiding. TaxonKit demonstrates competitive performance in execution time compared to similar tools. The efficiency, scalability, and usability of TaxonKit enable researchers to rapidly investigate taxonomy data.\n\nAvailabilityTaxonkit is implemented in Go programming language. It is open-source and freely available for download and use from https://github.com/shenwei356/taxonkit.

bioinformatics↗

bioRxiv2018

Global Quantitative Mapping of Enhancers in Rice Genome by STARR-seq

Identification of enhancers has been a challenge in plants. STARR-seq measures enhancer activity of millions fragments in parallel. Here we present a global map of rice enhancers quantitatively determined using STARR-seq. Most enhancers are mapped within genes, especially at the 5 untranslated regions (5 UTR) and the coding sequences. Silent and low expressed genes in genomic regions enriched with transposable elements (TEs) are frequently found containing proximal enhancers. Analysis of enhancer epigenetic features at their endogenous loci revealed that most enhancers do not co-localize with DNase I hypersensitive sites (DHSs) and are lack of H3K4me1. Clustering enhancers by their epigenetic modifications revealed that about 40% of identified enhancers carry one or more epigenetic marks. Repressive H3K27me3 is frequently enriched with positive marks of H3K4m3 and/or H3K27ac, which together may bookmark poised enhancers. Intergenic enhancers were predicted based on the location of DHS relative to genes, which overlap poorly with functionally identified enhancers. In summary, enhancers were quantitatively identified by functional analysis in a model plant genome, which provides a valuable resource for further mechanistic studies in different biological contexts.

genomics↗

bioRxiv2018

Long Non-Coding RNA LncKdm2b Regulates Cortical Neuronal Differentiation by Cis-Activating Kdm2b

The mechanisms underlying spatial and temporal control of cortical neurogenesis of the brain are largely elusive. Long non-coding RNAs (lncRNAs) have emerged as essential cell fate regulators. Here we found LncKdm2b (also known as Kancr), a lncRNA divergently transcribed from a bidirectional promoter of Kdm2b, is transiently expressed during early differentiation of cortical projection neurons. Interestingly, Kdm2bs transcription is positively regulated in cis by LncKdm2b, which has intrinsic-activating function and facilitates a permissive chromatin environment at the Kdm2bs promoter by associating with hnRNPAB. Lineage tracing experiments and phenotypic analyses indicated LncKdm2b and Kdm2b are crucial in proper differentiation and migration of cortical projection neurons. Moreover, KDM2B exerts its role relying on its leucine-rich repeats (LRR) but independent of its PRC1-related function. These observations unveiled a lncRNA-dependent machinery in regulating cortical neuronal differentiation.

molecular biology↗

bioRxiv2017

Role of the Visual Experience-Dependent Nascent Proteome in Neuronal Plasticity

Experience-dependent synaptic plasticity refines brain circuits during development. To identify novel protein synthesis-dependent mechanisms contributing to experience-dependent plasticity, we conducted a quantitative proteomic screen of the nascent proteome in response to visual experience in Xenopus optic tectum using bio-orthogonal metabolic labeling (BONCAT). We identified 83 differentially synthesized candidate plasticity proteins (CPPs). The CPPs form strongly interconnected networks and are annotated to a variety of biological functions, including RNA splicing, protein translation, and chromatin remodeling. Functional analysis of select CPPs revealed the requirement for eukaryotic initiation factor 3 subunit A (eIF3A), fused in sarcoma (FUS), and ribosomal protein s17 (RPS17) in experience-dependent structural plasticity in tectal neurons and behavioral plasticity in tadpoles. These results demonstrate that the nascent proteome is dynamic in response to visual experience and that de novo synthesis of machinery that regulates RNA splicing and protein translation is required for experience-dependent plasticity.\n\nHighlightsO_LIThe nascent proteome changes dynamically in response to visual experience\nC_LIO_LINewly synthesized candidate plasticity proteins were identified using MS/MS\nC_LIO_LIVisual experience induces de novo synthesis of synaptic and cytoskeletal proteins\nC_LIO_LISynthesis of RNA splicing and translation machinery is required for plasticity\nC_LI\n\neTOC BlurbLiu et al. show that the nascent proteome changes dynamically in response to plasticity-inducing visual experience. Functional analysis reveals that visual experience-dependent synthesis of RNA splicing and protein translation machinery is required for plasticity.

neuroscience↗

bioRxiv2017

Cell-autonomous regulation of structural and functional plasticity in inhibitory neurons by excitatory synaptic inputs

Functional circuit assembly is thought to require coordinated development of excitation and inhibition, but whether they are co-regulated cell-autonomously remains unclear. We investigated effects of decreased glutamatergic synaptic input on inhibitory synapses by expressing AMPAR subunit, GluA1 and GluA2, C-terminal peptides (GluA1CTP and GluA2CTP) in developing Xenopus tectal neurons. GluACTP decreased excitatory synaptic inputs and cell-autonomously decreased inhibitory synaptic inputs in excitatory and inhibitory neurons. Visually-evoked excitatory and inhibitory currents decreased proportionately, maintaining excitation/inhibition. GluACTP affected dendrite structure and visual experience-dependent structural plasticity differently in excitatory and inhibitory neurons. Deficits in excitatory and inhibitory synaptic transmission and experience-dependent plasticity manifested in altered visual receptive field properties. Both visual avoidance behavior and learning-induced behavioral plasticity were impaired, suggesting that maintaining excitation/inhibition alone is insufficient to preserve circuit function. We demonstrate that excitatory synaptic dysfunction in individual neurons cell-autonomously decreases inhibitory inputs and disrupts neuronal and circuit plasticity, information processing and learning.

neuroscience↗

bioRxiv2017

An internal sensor detects dietary amino acids and promotes food consumption in Drosophila

Adequate protein intake is crucial for animals. Despite the recent progress in understanding protein hunger and satiety in the fruit fly Drosophila melanogaster, how fruit flies assess prospective dietary protein sources and ensure protein consumption remains elusive. We show here that three specific amino acids, L-glutamate (L-Glu), L-alanine (L-Ala), and L-aspartate (L-Asp), rapidly promote food consumption in fruit flies when present in food. The effect of dietary amino acids to promote food consumption is independent of mating experience and internal nutritional status. Genetic analysis identifies six brain neurons expressing diuretic hormone 44 (DH44) as a sensor of dietary amino acids. DH44+ neurons can be directly activated by these three amino acids, and are both necessary and sufficient for dietary amino acids to promote food consumption. By conducting single cell RNAseq analysis, we also identify an amino acid transporter, CG13248, which is highly expressed in DH44+ neurons and is required for dietary amino acids to promote food consumption. Therefore, these data suggest that dietary amino acids may enter DH44+ neurons via CG13248 and modulate their activity and hence food consumption. Taken together, these data identify an internal amino acid sensor in the fly brain that evaluate food sources post-ingestively and facilitates adequate protein intake.

neuroscience↗

bioRxiv2017

Complemented palindrome small RNAs first discovered from SARS coronavirus

In this study, we reported for the first time the existence of complemented palindrome small RNAs (cpsRNAs) and proposed cpsRNAs and palindrome small RNAs (psRNAs) as a novel class of small RNAs. The first discovered cpsRNA UCUUUAACAAGCUUGUUAAAGA from SARS coronavirus named SARS-CoV-cpsR-22 contained 22 nucleotides perfectly matching its reverse complementary sequence. Further sequence analysis supported that SARS-CoV-cpsR-22 originated from bat betacoronavirus. The results of RNAi experiments showed that one 19-nt segment of SARS-CoV-cpsR-22 significantly induced cell apoptosis. These results suggested that SARS-CoV-cpsR-22 could play a role in SARS-CoV infection or pathogenicity. The discovery of psRNAs and cpsRNAs paved the way to find new markers for pathogen detection and reveal the mechanisms in the infection or pathogenicity from a different point of view. The discovery of psRNAs and cpsRNAs also broaden the understanding of palindrome motifs in animal of plant genomes.

genomics↗

bioRxiv2016

HBP: an integrative and flexible pipeline for the interaction analysis of Hi-C dataset

BackgroundThe spatial organization of interphase chromatin in the nucleus play an important role in gene expression regulation and function. With the rapid development of revolutionized chromosome conformation capture technology and its genome-wide derivatives such as Hi-C, investigation of the genome folding becomes more efficient and convenient. How to robustly deal with these massive datasets and infer accurate 3D model and within-nucleus compartmentalization of chromosomes becomes a new challenge.\n\nResultThe implemented pipeline HBP (Hi-C BED file analysis Pipeline) integrates existing pipelines focusing on individual steps of Hi-C data processing into an all-in-one package with adjustable parameters to infer the consensus 3D structure of genome from raw Hi-C sequencing data. Whats more, HBP could assign statistical confidence estimation for chromatin interactions, and clustering interaction loci according to enrichment tracks or topological structure automatically.\n\nConclusionThe freely available HBP is an optimized and flexible pipeline for analyzing the folding of whole chromosome and interactions between some specific sites from the Hi-C raw sequencing reads to the partially processed datasets. The other complex genetic and epigenetic datasets from public sources such as GWAS, ENCODE consortiums etc. will also easily be integrated into HBP, hence the final output results of HBP could provide a comprehensive in-depth understanding for the specific chromatin interactions, potential molecular mechanisms and biological significance. We believe that HBP is a reliable tool for the rapidly analysis of Hi-C data and will be very useful for a wide range of researchers, particularly those who lack of background in computational biology. HBP is freely accessible at https://github.com/hechao0407/HBP/blob/master/HBP_1.0.tar.gz.

bioinformatics↗