bioRxiv ScienceSearch

Biology subjects

Shen, W.

Publications and source records attributed to Shen, W..

5 recordsLinked to original sources

Role of the Visual Experience-Dependent Nascent Proteome in Neuronal Plasticity

Experience-dependent synaptic plasticity refines brain circuits during development. To identify novel protein synthesis-dependent mechanisms contributing to experience-dependent plasticity, we conducted a quantitative proteomic screen of the nascent proteome in response to visual experience in Xenopus optic tectum using bio-orthogonal metabolic labeling (BONCAT). We identified 83 differentially synthesized candidate plasticity proteins (CPPs). The CPPs form strongly interconnected networks and are annotated to a variety of biological functions, including RNA splicing, protein translation, and chromatin remodeling. Functional analysis of select CPPs revealed the requirement for eukaryotic initiation factor 3 subunit A (eIF3A), fused in sarcoma (FUS), and ribosomal protein s17 (RPS17) in experience-dependent structural plasticity in tectal neurons and behavioral plasticity in tadpoles. These results demonstrate that the nascent proteome is dynamic in response to visual experience and that de novo synthesis of machinery that regulates RNA splicing and protein translation is required for experience-dependent plasticity.\n\nHighlightsO_LIThe nascent proteome changes dynamically in response to visual experience\nC_LIO_LINewly synthesized candidate plasticity proteins were identified using MS/MS\nC_LIO_LIVisual experience induces de novo synthesis of synaptic and cytoskeletal proteins\nC_LIO_LISynthesis of RNA splicing and translation machinery is required for plasticity\nC_LI\n\neTOC BlurbLiu et al. show that the nascent proteome changes dynamically in response to plasticity-inducing visual experience. Functional analysis reveals that visual experience-dependent synthesis of RNA splicing and protein translation machinery is required for plasticity.

neuroscience

Cell-autonomous regulation of structural and functional plasticity in inhibitory neurons by excitatory synaptic inputs

Functional circuit assembly is thought to require coordinated development of excitation and inhibition, but whether they are co-regulated cell-autonomously remains unclear. We investigated effects of decreased glutamatergic synaptic input on inhibitory synapses by expressing AMPAR subunit, GluA1 and GluA2, C-terminal peptides (GluA1CTP and GluA2CTP) in developing Xenopus tectal neurons. GluACTP decreased excitatory synaptic inputs and cell-autonomously decreased inhibitory synaptic inputs in excitatory and inhibitory neurons. Visually-evoked excitatory and inhibitory currents decreased proportionately, maintaining excitation/inhibition. GluACTP affected dendrite structure and visual experience-dependent structural plasticity differently in excitatory and inhibitory neurons. Deficits in excitatory and inhibitory synaptic transmission and experience-dependent plasticity manifested in altered visual receptive field properties. Both visual avoidance behavior and learning-induced behavioral plasticity were impaired, suggesting that maintaining excitation/inhibition alone is insufficient to preserve circuit function. We demonstrate that excitatory synaptic dysfunction in individual neurons cell-autonomously decreases inhibitory inputs and disrupts neuronal and circuit plasticity, information processing and learning.

neuroscience

An internal sensor detects dietary amino acids and promotes food consumption in Drosophila

Adequate protein intake is crucial for animals. Despite the recent progress in understanding protein hunger and satiety in the fruit fly Drosophila melanogaster, how fruit flies assess prospective dietary protein sources and ensure protein consumption remains elusive. We show here that three specific amino acids, L-glutamate (L-Glu), L-alanine (L-Ala), and L-aspartate (L-Asp), rapidly promote food consumption in fruit flies when present in food. The effect of dietary amino acids to promote food consumption is independent of mating experience and internal nutritional status. Genetic analysis identifies six brain neurons expressing diuretic hormone 44 (DH44) as a sensor of dietary amino acids. DH44+ neurons can be directly activated by these three amino acids, and are both necessary and sufficient for dietary amino acids to promote food consumption. By conducting single cell RNAseq analysis, we also identify an amino acid transporter, CG13248, which is highly expressed in DH44+ neurons and is required for dietary amino acids to promote food consumption. Therefore, these data suggest that dietary amino acids may enter DH44+ neurons via CG13248 and modulate their activity and hence food consumption. Taken together, these data identify an internal amino acid sensor in the fly brain that evaluate food sources post-ingestively and facilitates adequate protein intake.

neuroscience

Complemented palindrome small RNAs first discovered from SARS coronavirus

In this study, we reported for the first time the existence of complemented palindrome small RNAs (cpsRNAs) and proposed cpsRNAs and palindrome small RNAs (psRNAs) as a novel class of small RNAs. The first discovered cpsRNA UCUUUAACAAGCUUGUUAAAGA from SARS coronavirus named SARS-CoV-cpsR-22 contained 22 nucleotides perfectly matching its reverse complementary sequence. Further sequence analysis supported that SARS-CoV-cpsR-22 originated from bat betacoronavirus. The results of RNAi experiments showed that one 19-nt segment of SARS-CoV-cpsR-22 significantly induced cell apoptosis. These results suggested that SARS-CoV-cpsR-22 could play a role in SARS-CoV infection or pathogenicity. The discovery of psRNAs and cpsRNAs paved the way to find new markers for pathogen detection and reveal the mechanisms in the infection or pathogenicity from a different point of view. The discovery of psRNAs and cpsRNAs also broaden the understanding of palindrome motifs in animal of plant genomes.

genomics

HBP: an integrative and flexible pipeline for the interaction analysis of Hi-C dataset

BackgroundThe spatial organization of interphase chromatin in the nucleus play an important role in gene expression regulation and function. With the rapid development of revolutionized chromosome conformation capture technology and its genome-wide derivatives such as Hi-C, investigation of the genome folding becomes more efficient and convenient. How to robustly deal with these massive datasets and infer accurate 3D model and within-nucleus compartmentalization of chromosomes becomes a new challenge.\n\nResultThe implemented pipeline HBP (Hi-C BED file analysis Pipeline) integrates existing pipelines focusing on individual steps of Hi-C data processing into an all-in-one package with adjustable parameters to infer the consensus 3D structure of genome from raw Hi-C sequencing data. Whats more, HBP could assign statistical confidence estimation for chromatin interactions, and clustering interaction loci according to enrichment tracks or topological structure automatically.\n\nConclusionThe freely available HBP is an optimized and flexible pipeline for analyzing the folding of whole chromosome and interactions between some specific sites from the Hi-C raw sequencing reads to the partially processed datasets. The other complex genetic and epigenetic datasets from public sources such as GWAS, ENCODE consortiums etc. will also easily be integrated into HBP, hence the final output results of HBP could provide a comprehensive in-depth understanding for the specific chromatin interactions, potential molecular mechanisms and biological significance. We believe that HBP is a reliable tool for the rapidly analysis of Hi-C data and will be very useful for a wide range of researchers, particularly those who lack of background in computational biology. HBP is freely accessible at https://github.com/hechao0407/HBP/blob/master/HBP_1.0.tar.gz.

bioinformatics