Biology subjects

Lange, K. I.

Publications and source records attributed to Lange, K. I..

4 recordsLinked to original sources

bioRxiv2025

Synthetic guide sequence to generate CRISPR-Cas9 entry strains in C. elegans

CRISPR/Cas9 genome editing has become an important and routine method in C. elegans research to generate new mutants and endogenously tag genes. One complication of CRISPR experiments is that the efficiency of single-guide RNA sequences can vary dramatically. One solution to this problem is to create an intermediate entry strain using the efficient and well-characterised dpy-10 guide RNA sequence. This "d10 entry strain" can then be used to generate your knock-in of interest. However, the dpy-10 sequence is not always suitable when creating an entry strain. For example, if your gene of interest is closely linked to dpy-10 on LGII or if you want to use the dpy-10 as a co-CRISPR marker for the creation of the entry strain then you can not use the dpy-10 sequence. This publication reports a synthetic guide sequence, GCTATCAACTATCCATATCG, that is not present in the C. elegans genome and can be used to create entry strains. This guide sequence is demonstrated to be relatively robust with a knock-in efficiency that varies from 1-11%. While this is lower than the efficiency observed with d10 entry strains, it is still sufficient for most applications. This guide sequence can be added to the C. elegans CRISPR toolkit and is particularly useful for generating entry strains where the standard dpy-10 guide sequence is not suitable.

genetics↗

bioRxiv2024

Two functional forms of the Meckel-Gruber syndrome protein TMEM67 generated by proteolytic cleavage by ADAMTS9 mediate Wnt signaling and ciliogenesis

TMEM67 mutations are the major cause of Meckel-Gruber syndrome. TMEM67 is involved in both ciliary transition zone assembly, and non-canonical Wnt signaling mediated by its extracellular domain. How TMEM67 performs these two separate functions is not known. We identify a novel cleavage motif in the extracellular domain of TMEM67 cleaved by the extracellular matrix metalloproteinase ADAMTS9. This cleavage regulates the abundance of two functional forms: A C-terminal portion which localizes to the ciliary transition zone regulating ciliogenesis, and a non- cleaved form which regulates Wnt signaling. By characterizing three TMEM67 ciliopathy patient variants within the cleavage motif utilizing mammalian cell culture and C. elegans, we show the cleavage motif is essential for cilia structure and function, highlighting its clinical significance. We generated a novel non-cleavable TMEM67 mouse model which develop severe ciliopathies phenocopying Tmem67-/- mice, but in contrast, undergo normal Wnt signaling, substantiating the existence of two functional forms of TMEM67.

cell biology↗

bioRxiv2021

Interpreting TMEM67 missense variants of uncertain significance (VUS) in an animal model

PurposeBetter methods are required to interpret the pathogenicity of disease-associated variants of uncertain significance (VUS), which cannot be actioned clinically. In this study, we explore the use of a tractable animal model (Caenorhabditis elegans) for in vivo interpretation of missense VUS alleles of TMEM67, a cilia gene associated with ciliopathies. MethodsCRISPR/Cas9 gene editing was used to generate homozygous knock-in C. elegans worm strains carrying TMEM67 patient variants engineered into the orthologous gene (mks-3). Quantitative phenotypic assays of sensory cilia structure and function measured if the variants affect mks-3 gene function. Results from worms were validated by a genetic complementation assay in a human TMEM67 knock-out hTERT-RPE1 cell line that tests a TMEM67 signaling function. ResultsAssays in C. elegans accurately distinguished between known benign (Asp359Glu, Thr360Ala) and known pathogenic (Glu361Ter, Gln376Pro) variants. Analysis of eight missense VUS generated evidence that three are benign (Cys173Arg, Thr176Ile, Gly979Arg) and five are pathogenic (Cys170Tyr, His782Arg, Gly786Glu, His790Arg, Ser961Tyr). ConclusionEfficient genome editing and quantitative functional assays in C. elegans make it a tractable in vivo animal model that allows rapid, cost-effective interpretation of ciliopathy-associated missense VUS alleles.

genetics↗

bioRxiv2020

Interpreting the pathogenicity of Joubert Syndrome missense variants in Caenorhabditis elegans

Ciliopathies are inherited disorders caused by cilia defects. Variants in ciliopathy genes are frequently pleiotropic and represent excellent case studies for interrogating genotype-phenotype correlation. We have employed Caenorhabditis elegans and gene editing to characterise two pathogenic biallelic missense variants (P74S, G155S) in B9D2/mksr-2 associated with Joubert Syndrome (JBTS). B9D2 functions within the MKS module at the transition zone (TZ) ciliary subcompartment, and regulates the ciliums molecular composition and signaling function. Quantitative assays of cilium/TZ structure and function, together with knock-in reporters, confirm both variant alleles are pathogenic. G155S causes a more severe overall phenotype and disrupts endogenous MKSR-2 organisation at the TZ. Recapitulation of the patient biallelic genotype shows that heterozygous worms phenocopy worms homozygous for P74S. This study also reveals a close functional association between the B9 complex and TMEM216/MKS-2. These data establish C. elegans as a paradigm for interpreting JBTS mutations, and provide insight into MKS module organisation.

genetics↗