Biology subjects

Hu, Y.

Publications and source records attributed to Hu, Y..

At least 685 records · Page 38Linked to original sources

bioRxiv2018

Increased autophagy in ephrinB2 deficient osteocytes is associated with hypermineralized, brittle bones

Mineralized bone forms when collagen-containing osteoid accrues hydroxyapatite crystals. This process has two phases: a rapid initiation (primary mineralization), followed by slower accrual of mineral (secondary mineralization) that continues until that portion of bone is renewed by remodelling. Within the bone matrix is an interconnected network of cells termed osteocytes. These cells are derived from bone-forming osteoblasts. Osteoblast differentiation requires expression of ephrinB2, and we were intrigued about why ephrinB2 continues to be expressed in mature osteocytes. To determine its function in osteocytes, we developed an osteocyte-specific ephrinB2 null mouse and found they exhibited a brittle bone phenotype. This was not caused by a change in bone mass, but by an intrinsic defect in the strength of the bone material. Although the initiation of osteoid mineralization occurred at a normal rate, the process of secondary mineralization was accelerated in these mice. The maturing mineralized bone matrix incorporated mineral and carbonate more rapidly than controls, indicating that osteocytic ephrinB2 suppresses mineral accumulation in bone. No known regulators of mineralization were modified in the bone of these mice. However, RNA sequencing showed differential expression of a group of autophagy-associated genes, and increased autophagic flux was confirmed in ephrinB2 knockdown osteocytes. This indicates that the process of secondary mineralization in bone makes use of autophagic machinery in a manner that is limited by ephrinB2 in osteocytes, and that this process may be disrupted in conditions of bone fragility.

cell biology↗

bioRxiv2018

Genetically increased serum calcium levels reduce Alzheimer’s disease risk

IMPORTANCE Alzheimers disease (AD) is the leading cause of disability in the elderly. It has been a long time about the calcium hypothesis of AD on the basis of emerging evidence since 1994. However, most studies focused on the association between calcium homeostasis and AD, and concerned the intracellular calcium concentration. Only few studies reported reduced serum calcium levels in AD. Until now, it remains unclear whether serum calcium levels are genetically associated with AD risk.\n\nOBJECTIVE To evaluate the genetic association between increased serum calcium levels and AD risk\n\nDESIGN, SETTING, AND PARTICIPANTS We performed a Mendelian randomization study to investigate the association of increased serum calcium with AD risk using the genetic variants from the large-scale serum calcium genome-wide association study (GWAS) dataset (N=61,079 individuals of European descent) and the large-scale AD GWAS dataset (N=54,162 individuals including 17,008 AD cases and 37,154 controls of European descent). Inverse-variance weighted meta-analysis (IVW) was used to provide a combined estimate of the genetic association. Meanwhile, we selected the weighted median regression and MR-Egger regression as the complementary analysis methods to examine the robustness of the IVW estimate.\n\nEXPOSURES Genetic predisposition to increased serum calcium levels\n\nMAIN OUTCOMES AND MEASURES The risk of AD.\n\nRESULTS We selected 6 independent genetic variants influencing serum calcium levels as the instrumental variables. IVW analysis showed that a genetically increased serum calcium level (per 1 standard deviation (SD) increase 0.5-mg/dL) was significantly associated with a reduced AD risk (OR=0.56, 95% CI: 0.34-0.94, P=5.00E-03). Meanwhile, both the weighted median estimate (OR=0.60, 95% CI: 0.34-1.06, P=0.08) and MR-Egger estimate (OR=0.66, 95% CI: 0.26-1.67, P=0.381) were consistent with the IVW estimate in terms of direction and magnitude.\n\nCONCLUSIONS AND RELEVANCE We provided evidence that genetically increased serum calcium levels could reduce the risk of AD. Meanwhile, randomized controlled study should be further conducted to assess the effect of serum calcium levels on AD risk, and further clarify whether diet calcium intake or calcium supplement, or both could reduce the risk of AD.\n\nKey PointsQuestion Is there a genetic relationship between elevated serum calcium levels and the risk of Alzheimers disease?\n\nFindings This Mendelian randomization study showed that the genetically increased serum calcium levels were associated with the reduced risk of Alzheimers disease.\n\nMeaning These findings provide evidence that genetically increased serum calcium levels could reduce the risk of Alzheimers disease.

genetics↗

bioRxiv2018

Locally distributed abstraction of temporal distance in human parietal cortex

An enduring puzzle in the neuroscience of memory is how the brain parsimoniously situates past events by their order in relation to time. By combining functional MRI, and representational similarity analysis, we reveal a multivoxel representation of time intervals separating pairs of episodic event-moments in the posterior medial memory system, especially when the events were experienced within a similar temporal context. We further show such multivoxel representations to be vulnerable to disruption through targeted repetitive transcranial magnetic stimulation and that perturbation to the mnemonic abstraction alters the neural--behavior relationship across the wider parietal memory network. Our findings establish a mnemonic \"pattern-based\" code of temporal distances in the human brain, a fundamental neural mechanism for supporting the temporal structure of past events, assigning the precuneus as a locus of flexibly effecting the manipulation of physical time during episodic memory retrieval.

neuroscience↗

bioRxiv2017

Self-assembling all-enzyme hydrogels for biocatalytic flow processes

We describe the construction of binary self-assembling all-enzyme hydrogels that are comprised entirely of two tetrameric globular enzymes, the stereoselective dehydrogenase LbADH and the cofactor-regenerating glucose 1-dehydrogenase GDH. The enzymes were genetically fused with a SpyTag or SpyCatcher domain, respectively, to generate two complementary homo-tetrameric building blocks that polymerise under physiological conditions into porous hydrogels. The biocatalytic gels were used for the highly stereoselective reduction of a prochiral diketone substrate where they showed the typical behaviour of the coupled kinetics of coenzyme regenerating reactions in the substrate channelling regime. They effectively sequestrate the NADPH cofactor even under continuous flow conditions. Owing to their sticky nature, the gels can be readily mounted in simple microfluidic reactors without the need for supportive membranes. The reactors revealed extraordinary high space-time yields with nearly quantitative conversion (>95%), excellent stereoselectivity (d.r. > 99:1), and total turnover numbers of the expensive cofactor NADP(H) that are amongst the highest values ever reported.\n\nO_FIG O_LINKSMALLFIG WIDTH=200 HEIGHT=135 SRC=\"FIGDIR/small/240325_ufig1.gif\" ALT=\"Figure 1\">\nView larger version (30K):\norg.highwire.dtl.DTLVardef@19a66b9org.highwire.dtl.DTLVardef@1ce1a41org.highwire.dtl.DTLVardef@1dac96org.highwire.dtl.DTLVardef@2db317_HPS_FORMAT_FIGEXP M_FIG C_FIG

biochemistry↗

bioRxiv2017

Reanalysis of global proteomic and phosphoproteomic data identified a large number of glycopeptides

Protein glycosylation plays fundamental roles in many cellular processes, and previous reports have shown dysregulation to be associated with several human diseases, including diabetes, cancer, and neurodegenerative disorders. Despite the vital role of glycosylation for proper protein function, the analysis of glycoproteins has been lagged behind to other protein modifications. In this study, we describe the re-analysis of global proteomic data from breast cancer xenograft tissues using recently developed software package GPQuest 2.0, revealing a large number of previously unidentified N-linked glycopeptides. More importantly, we found that using immobilized metal affinity chromatography (IMAC) technology for the enrichment of phosphopeptides had co-enriched a substantial number of sialoglycopeptides, allowing for a large-scale analysis of sialoglycopeptides in conjunction with the analysis of phosphopeptides. Collectively, combined MS/MS analyses of global proteomic and phosphoproteomic datasets resulted in the identification of 6,724 N-linked glycopeptides from 617 glycoproteins derived from two breast cancer xenograft tissues. Next, we utilized GPQuest for the re-analysis of global and phosphoproteomic data generated from 108 human breast cancer tissues that were previously analyzed by Clinical Proteomic Analysis Consortium (CPTAC). Reanalysis of the CPTAC dataset resulted in the identification of 2,683 glycopeptides from the global proteomic data set and 4,554 glycopeptides from phosphoproteomic data set, respectively. Together, 11,292 N-linked glycopeptides corresponding to 1,731 N-linked glycosites from 883 human glycoproteins were identified from the two data sets. This analysis revealed an extensive number of glycopeptides hidden in the global and enriched in IMAC-based phosphopeptide-enriched proteomic data, information which would have remained unknown from the original study otherwise. The reanalysis described herein can be readily applied to identify glycopeptides from already existing data sets, providing insight into many important facets of protein glycosylation in different biological, physiological, and pathological processes.

systems biology↗

bioRxiv2017

Testing hypotheses about the microbiome using an ordination-based linear decomposition model

MotivationMethods for analyzing microbiome data generally fall into one of two groups: tests of the global hypothesis of any microbiome effect, which do not provide any information on the contribution of individual operational taxonomic units (OTUs); and tests for individual OTUs, which do not typically provide a global test of microbiome effect. Without a unified approach, the findings of a global test may be hard to resolve with the findings at the individual OTU level. Further, many tests of individual OTU effects do not preserve the false discovery rate (FDR). ResultsWe introduce the linear decomposition model (LDM), that provides a single analysis path that includes global tests of any effect of the microbiome, tests of the effects of individual OTUs while accounting for multiple testing by controlling the FDR, and a connection to distance-based ordination. The LDM accommodates both continuous and discrete variables (e.g., clinical outcomes, environmental factors) as well as interaction terms to be tested either singly or in combination, allows for adjustment of confounding covariates, and uses permutation-based p-values that can control for correlation. The LDM can also be applied to transformed data, and an "omnibus" test can easily combine results from analyses conducted on different transformation scales. We also provide a new implementation of PERMANOVA based on our approach. For global testing, our simulations indicate the LDM provided correct type I error and can have comparable power to existing distance-based methods. For testing individual OTUs, our simulations indicate the LDM controlled the FDR well. In contrast, DESeq2 often had inflated FDR; MetagenomeSeq generally had the lowest sensitivity. The flexibility of the LDM for a variety of microbiome studies is illustrated by the analysis of data from two microbiome studies. We also show that our implementation of PERMANOVA can outperform existing implementations.

bioinformatics↗

bioRxiv2017

GABAergic deficits and schizophrenia-like behaviors in a mouse model carrying patient-derived neuroligin-2 R215H mutation

Schizophrenia (SCZ) is a severe mental disorder characterized by delusion, hallucination, and cognitive deficits. We have previously identified from schizophrenia patients a loss-of-function mutation Arg215 [->] His215 (R215H) of neuroligin 2 (NLGN2) gene, which encodes a cell adhesion molecule critical for GABAergic synapse formation and function. Here, we generated a novel transgenic mouse line with neuroligin-2 (NL2) R215H mutation, which showed a significant loss of NL2 protein, reduced GABAergic transmission, and impaired hippocampal activation. Importantly, R215H KI mice displayed anxiety-like behaviors, impaired pre-pulse inhibition (PPI), cognition deficits and abnormal stress responses, recapitulating several key aspects of schizophrenia-like behavior. Our results demonstrate a significant impact of a single point mutation NL2 R215H on brain functions, providing a novel animal model for the study of schizophrenia and neuropsychiatric disorders.

neuroscience↗

bioRxiv2017

Combining accurate tumour genome simulation with crowd sourcing to benchmark somatic structural variant detection

BackgroundThe phenotypes of cancer cells are driven in part by somatic structural variants. Structural variants can initiate tumors, enhance their aggressiveness and provide unique therapeutic opportunities. Whole-genome sequencing of tumors can allow exhaustive identification of the specific structural variants present in an individual cancer, facilitating both clinical diagnostics and the discovery of novel mutagenic mechanisms. A plethora of somatic structural variant detection algorithms have been created to enable these discoveries, however there are no systematic benchmarks of them. Rigorous performance evaluation of somatic structural variant detection methods has been challenged by the lack of gold-standards, extensive resource requirements and difficulties arising from the need to share personal genomic information.\n\nResultsTo facilitate structural variant detection algorithm evaluations, we create a robust simulation framework for somatic structural variants by extending the BAMSurgeon algorithm. We then organize and enable a crowd-sourced benchmarking within the ICGC-TCGA DREAM Somatic Mutation Calling Challenge (SMC-DNA). We report here the results of structural variant benchmarking on three different tumors, comprising 204 submissions from 15 teams. In addition to ranking methods, we identify characteristic error-profiles of individual algorithms and general trends across them. Surprisingly, we find that ensembles of analysis pipelines do not always outperform the best individual method, indicating a need for new ways to aggregate somatic structural variant detection approaches.\n\nConclusionsThe synthetic tumors and somatic structural variant detection leaderboards remain available as a community benchmarking resource, and BAMSurgeon is available at https://github.com/adamewing/bamsurgeon.

bioinformatics↗

bioRxiv2017

Invariances in a combinatorial olfactory receptor code

Animals can identify an odorant type across a wide range of concentrations, as well as detect changes in concentration for individual odorant type. How olfactory representations are structured to support these functions remains poorly understood. Here, we studied how a full complement of ORNs in the Drosophila larva encodes a broad input space of odorant types and concentrations. We find that dose-response relationships across odorants and ORN types follow the Hill function with shared cooperativity but different activation thresholds. These activation thresholds are drawn from a power law statistical distribution. A fixed activation function and power law distribution of activation thresholds underlie invariances in the encoding of odorant identity and intensity. Moreover, we find similar temporal response filters of ORNs across odorant types and concentrations. Such uniformity in the temporal filter may allow identity invariant coding in fluctuating or turbulent odor environments. Common patterns in ligand-receptor binding and sensory transduction across olfactory receptors may give rise to these observed invariances in the olfactory combinatorial code. Invariant patterns in the activity responses of individual ORNs and the ORN ensemble may simplify decoding by downstream circuits.

neuroscience↗

bioRxiv2017

Deficit in parietal memory network underlies auditory hallucination: a longitudinal study

Auditory hallucination is a prominent and common symptom in schizophrenia. Previous neuroimaging studies have yielded mixed results of its brain network deficits. We proposed a novel hypothesis that parietal memory network, centered at the precuneus, plays a critical role in auditory hallucination. This network is adjacent and partially overlaps with the default mode network, and has been associated with brain function of familiarity labelling in memory processing. Using a longitudinal design and a large cohort of first-episode, drug-naive schizophrenia patients, we examined this hypothesis and further investigated whether the functional connectivity patterns of the parietal memory network can serve as a neuroimaging marker for auditory hallucination and help to predict future treatment effects. Resting-state scans from 59 first-episode drug-naive schizophrenic patients (27 with and 32 without hallucination) and 53 healthy control subjects were acquired at the baseline test, and 56 of them were scanned again after two months. Functional connectivity strength within the parietal memory network and between this network and memory hubs was across the three groups at baseline and follow-up scans. Results showed that decreased functional connectivity strength within the parietal memory network was specific to the auditory hallucination group (p = 0.009, compare to the healthy subjects; p = 0.029, compare to the patients without hallucination), with the precuneus representing the largest group difference. The intra-network connectivity strength of the precuneus negatively correlated with the severity of hallucination at the baseline scan (r = -0.437, p = 0.029), and it was significantly increased after two-month medication (p = 0.039). Logistic regression analysis and crossvalidation test demonstrated that the functional connectivity strength of the precuneus and precuneus-hippocampus connectivity could differentiate patients with or without auditory hallucination with a sensitivity of 0.750 and a specificity of 0.708. Moreover, crossvalidation test showed that these imaging features at the baseline scan well predicted the extents of positive symptom improvement in the hallucination group after the two-month medication (R2 = 0.433, p = 0.022). Our results provide evidence for a critical role of the parietal memory network underlying auditory hallucination, and further propose a novel neuroimaging marker for identifying patients, accessing severity, and prognosis of treatment effect for auditory hallucination.\n\nAbbreviations

neuroscience↗

bioRxiv2017

Complemented palindrome small RNAs first discovered from SARS coronavirus

In this study, we reported for the first time the existence of complemented palindrome small RNAs (cpsRNAs) and proposed cpsRNAs and palindrome small RNAs (psRNAs) as a novel class of small RNAs. The first discovered cpsRNA UCUUUAACAAGCUUGUUAAAGA from SARS coronavirus named SARS-CoV-cpsR-22 contained 22 nucleotides perfectly matching its reverse complementary sequence. Further sequence analysis supported that SARS-CoV-cpsR-22 originated from bat betacoronavirus. The results of RNAi experiments showed that one 19-nt segment of SARS-CoV-cpsR-22 significantly induced cell apoptosis. These results suggested that SARS-CoV-cpsR-22 could play a role in SARS-CoV infection or pathogenicity. The discovery of psRNAs and cpsRNAs paved the way to find new markers for pathogen detection and reveal the mechanisms in the infection or pathogenicity from a different point of view. The discovery of psRNAs and cpsRNAs also broaden the understanding of palindrome motifs in animal of plant genomes.

genomics↗

bioRxiv2017

Genetic Architecture of Subcortical Brain Structures in Over 40,000 Individuals Worldwide

Subcortical brain structures are integral to motion, consciousness, emotions, and learning. We identified common genetic variation related to the volumes of nucleus accumbens, amygdala, brainstem, caudate nucleus, globus pallidus, putamen, and thalamus, using genome-wide association analyses in over 40,000 individuals from CHARGE, ENIGMA and the UK-Biobank. We show that variability in subcortical volumes is heritable, and identify 25 significantly associated loci (20 novel). Annotation of these loci utilizing gene expression, methylation, and neuropathological data identified 62 candidate genes implicated in neurodevelopment, synaptic signaling, axonal transport, apoptosis, and susceptibility to neurological disorders. This set of genes is significantly enriched for Drosophila orthologs associated with neurodevelopmental phenotypes, suggesting evolutionarily conserved mechanisms. Our findings uncover novel biology and potential drug targets underlying brain development and disease.

genetics↗

bioRxiv2017

Zinc detoxification: a functional genomics and transcriptomics analysis in Drosophila melanogaster cultured cells

Cells require some metals, such as zinc and manganese, but excess levels of these metals can be toxic. As a result, cells have evolved complex mechanisms for maintaining metal homeostasis and surviving metal intoxication. Here, we present the results of a large-scale functional genomic screen in Drosophila cultured cells for modifiers of zinc chloride toxicity, together with transcriptomics data for wildtype or genetically zinc-sensitized cells challenged with mild zinc chloride supplementation. Altogether, we identified 47 genes for which knockdown conferred sensitivity or resistance to toxic zinc or manganese chloride treatment, and more than 1800 putative zinc-responsive genes. Analysis of the omics data points to the relevance of ion transporters, glutathione-related factors, and conserved disease-associated genes in zinc detoxification. Specific genes identified in the zinc screen include orthologs of human disease-associated genes CTNS, PTPRN (also known as IA-2), and ATP13A2 (also known as PARK9). We show that knockdown of red dog mine (rdog; CG11897), a candidate zinc detoxification gene encoding an ABCC-type transporter family protein related to yeast cadmium factor (YCF1), confers sensitivity to zinc intoxication in cultured cells and that rdog is transcriptionally up-regulated in response to zinc stress. As there are many links between the biology of zinc and other metals and human health, the omics datasets presented here provide a resource that will allow researchers to explore metal biology in the context of diverse health-relevant processes.

genetics↗

bioRxiv2017

Variable dose analysis: A novel RNAi-based method for detection of synthetic lethal interactions

Synthetic sick or synthetic lethal (SS/L) screens are a powerful way to identify candidate drug targets to specifically kill tumor cells but such screens generally suffer from low reproducibility. We found that many SS/L interactions involve essential genes and are therefore detectable within a limited range of knockdown efficiency. Such interactions are often missed by overly efficient RNAi reagents. We therefore developed an assay that measures viability over a range of knockdown efficiency within a cell population. This method, called variable dose analysis (VDA), is highly sensitive to viability phenotypes and reproducibly detects SS/L interactions. We applied the VDA method to search for SS/L interactions with TSC1 and TSC2, the two tumor suppressors underlying tuberous sclerosis complex (TSC) and generated a SS/L network for TSC. Using this network, we identified four FDA-approved drugs that selectively affect viability of TSC deficient cells, representing promising candidates for repurposing to treat TSC-related tumors.

cancer biology↗

bioRxiv2017

Colorectal cancer susceptibility loci as predictive markers of rectal cancer prognosis after surgery

BackgroundColorectal cancer (CRC) is among the leading causes of cancer death. Rectal cancers account for one third of CRC cases. The role and significance of colorectal cancer risk loci in rectal cancer progression has not been investigated.\n\nMethodsWe generated and explored a dataset from 230 rectal cancer patients by gene expression microarray analysis of cancer samples and matched controls, and SNP arrays of germline DNA.\n\nResults8q24 (upstream of MYC) and 18q21 (in the intron of SMAD7), two of the loci most strongly linked with colorectal cancer risk, as well as 20q13 (in the intron of LAMA5), are tightly associated with the prognosis of rectal cancer patients. For SNPs on 18q21 (rs12953717 and rs4464148) and 20q13 (rs4925386), alleles that correlate with higher risk for the development of colorectal cancer are associated with shorter disease free survival. However, for rs6983267 on 8q24, the low risk allele is associated with a higher risk for recurrence and metastasis after surgery, and importantly, is strongly correlated with the resistance of colorectal cancer cell lines to chemoradiotherapy. We also found that although MYC expression is dramatically increased in cancer, patients with higher levels of MYC have a better prognosis. The expression of SMAD7 is weakly correlated with disease free time. Notably, the presence of the 8q24 and 18q21 SNP alleles is not correlated with a change of expression of MYC and SMAD7. rs4464148, and probably rs6983267 and rs4925386, are linked with overall survival time of patients.\n\nConclusionsSNPs at three colorectal cancer risk loci detect subpopulations of rectal cancer patients with poor prognosis. rs6983267 probably affects prognosis through interfering with the resistance of cancer cells to chemoradiotherapy.

cancer biology↗

bioRxiv2017

Gene2Function: An Integrated Online Resource For Gene Function Discovery

One of the most powerful ways to develop hypotheses regarding biological functions of conserved genes in a given species, such as in humans, is to first look at what is known about function in another species. Model organism databases (MODs) and other resources are rich with functional information but difficult to mine. Gene2Function (G2F) addresses a broad need by integrating information about conserved genes in a single online resource.

bioinformatics↗

bioRxiv2017

Cross reactivity of antibodies against microbial proteins to human tissues as basis of Crohns disease and other autoimmune diseases

BackgroundAutoimmune disease is generally a systemic inflammatory response with production of autoantibodies. In this study, we investigated the anti-microbial antibodies in circulation in cases of Crohns disease (CD), Sjogrens syndrome (SS) and other autoimmune disease and their roles in the pathogenesis of these autoimmune diseases.\n\nMaterial and methodsWestern blot was used to determine the reactivity of human plasmas from patients with CD and SS as the primary antibodies against the whole microbial extracts. The microbial proteins reactive to patients plasma were further identified and the modified sandwich ELISA assays were used to determine the blood levels of antibodies against these microbial proteins in patients with CD and SS. Antibodies against the microbial proteins are used for immunohistochemical staining of normal human tissue.\n\nResultsA group of 7 microbial proteins was identified reactive to the plasmas of patients with CD and SS including DNA-directed RNA polymerase B (RPOB), and elongation factor G (EF-G) from Staphylococcus aureus and Staphylococcus pseudintermedius (S. aureus and S. pseudintermedius), ATP synthase alpha (ATP5a) and heat shock protein 65 (Hsp65) from Mycobacterium avium subspecies paratuberculosis (MAP), elongation factor Tu (EF-Tu) and outer membrane porin C (ompC) from Escherichia Coli (E. coli). Anti-microbial antibodies can cross-react to normal human tissues. The levels of antibodies against the microbial proteins are significantly elevated in the patients with CD and SS.\n\nConclusionThe levels of antibodies against the microbial proteins are significantly elevated in CD and SS. The cross-reactivity of the anti-microbial antibodies to human tissue provides a new mechanism of pathogenesis of autoimmune diseases such as CD and SS.

microbiology↗

bioRxiv2017

From the statistics of connectivity to the statistics of spike times in neuronal networks

An essential step toward understanding neural circuits is linking their structure and their dynamics. In general, this relationship can be almost arbitrarily complex. Recent theoretical work has, however, begun to identify some broad principles underlying collective spiking activity in neural circuits. The first is that local features of network connectivity can be surprisingly effective in predicting global statistics of activity across a network. The second is that, for the important case of large networks with excitatory-inhibitory balance, correlated spiking persists or vanishes depending on the spatial scales of recurrent and feedforward connectivity. We close by showing how these ideas, together with plasticity rules, can help to close the loop between network structure and activity statistics.\n\nHighlightsO_LIRemarkable new data on connectivity and activity raise the promise and raise the bar for linking structure and dynamics in neural networks.\nC_LIO_LIRecent theories aim at a statistical approach, in which the enormous complexity of wiring diagrams is reduced to key features of that connectivity that drive coherent, network-wide activity.\nC_LIO_LIWe provide a unified view of three branches of this work, tied to a broadly useful \"neural response\" formula that explicitly relates connectivity to spike train statistics.\nC_LIO_LIThis isolates a surprisingly systematic role for the local structure and spatial scale of connectivity in determining spike correlations, and shows how the coevolution of structured connectivity and spiking statistics through synaptic plasticity can be predicted self-consistently.\nC_LI

neuroscience↗