Biology subjects

Gao, S.

Publications and source records attributed to Gao, S..

240 records · Page 14Linked to original sources

bioRxiv2017

PPARD regulation in gastric progenitor cells drives gastric tumorigenesis in mice

Little is known about the cell origin of gastric cancer. Peroxisome proliferator-activated receptor-delta (PPARD) is a druggable ligand-activated nuclear receptor that impacts protumorigenic cellular events. However, PPARDs role in tumorigenesis, especially gastric tumorigenesis, remains to be defined. We found that targeting PPARD overexpression in murine gastric progenitor cells (GPC), via a villin promoter, spontaneously induced gastric tumorigenesis that progressed to invasive adenocarcinoma. PPARD overexpression in GPC upregulated tumorigenic proinflammatory cytokine and CD44 expression, expanded GPC population in vivo, enhanced GPC self-renewal and proliferation in organoid cultures, and endowed these cells with tumorigenic properties. Our findings identify PPARD as a driver of gastric tumorigenesis via GPC transformation.

cancer biology↗

bioRxiv2017

Identification of Cancer-associated Metabolic Vulnerabilities by Modeling Multi-objective Optimality in Metabolism

Computational modeling of the genome-wide metabolic network is essential for designing new therapeutics targeting cancer-associated metabolic disorder, which is a hallmark of human malignancies. However, previous studies generally assumed that metabolic fluxes of cancer cells are subjected to the maximization of biomass production, despite the wide existence of trade-offs among multiple metabolic objectives. To address this issue, we developed a multi-objective model of cancer metabolism with algorithms depicting approximate Pareto surfaces and incorporating multiple omics datasets. To validate this approach, we built individualized models for NCI-60 cancer cell lines, and accurately predicted cell growth rates and other biological consequences of metabolic perturbations in these cells. By analyzing the landscape of approximate Pareto surface, we identified a list of metabolic targets essential for cancer cell proliferation and the Warburg effect, and further demonstrated their close association with cancer patient survival. Finally, metabolic targets predicted to be essential for tumor progression were validated by cell-based experiments, confirming this multi-objective modelling method as a novel and effective strategy to identify cancer-associated metabolic vulnerabilities.

systems biology↗

bioRxiv2017

Complemented palindrome small RNAs first discovered from SARS coronavirus

In this study, we reported for the first time the existence of complemented palindrome small RNAs (cpsRNAs) and proposed cpsRNAs and palindrome small RNAs (psRNAs) as a novel class of small RNAs. The first discovered cpsRNA UCUUUAACAAGCUUGUUAAAGA from SARS coronavirus named SARS-CoV-cpsR-22 contained 22 nucleotides perfectly matching its reverse complementary sequence. Further sequence analysis supported that SARS-CoV-cpsR-22 originated from bat betacoronavirus. The results of RNAi experiments showed that one 19-nt segment of SARS-CoV-cpsR-22 significantly induced cell apoptosis. These results suggested that SARS-CoV-cpsR-22 could play a role in SARS-CoV infection or pathogenicity. The discovery of psRNAs and cpsRNAs paved the way to find new markers for pathogen detection and reveal the mechanisms in the infection or pathogenicity from a different point of view. The discovery of psRNAs and cpsRNAs also broaden the understanding of palindrome motifs in animal of plant genomes.

genomics↗

bioRxiv2017

High Current Optogenetic Channels For Stimulation And Inhibition Of Primary Rat Cortical Neurons

ChR2-XXL and GtACR1 are currently the cation and anion ends of the optogenetic single channel current range. These were used in primary rat cortical neurons in vitro to manipulate neuronal firing patterns. ChR2-XXL provides high cation currents via elevated light sensitivity and a prolonged open state. Stimulating ChR2-XXL expressing putative presynaptic neurons induced neurotransmission. Moreover, stable depolarisation block could be generated in single neurons using ChR2-XXL, proving that ChR2-XXL is a promising candidate for in vivo applications of optogenetics, for example to treat peripheral neuropathic pain. We also addressed an anion channelrhodopsin (GtACR1) for the next generation of optogenetic neuronal inhibition in primary rat cortical neurons. GtACR1 s light-gated chloride conduction was verified in primary neurons and the efficient photoinhibition of action potentials, including spontaneous activity, was shown. Our data also implies that the chloride concentration in neurons decreases during neural development. In both cases, we find surprising applications of these high current channels. For ChR2-XXL inhibition and stimulation are possible, while for GtACR1 the role of Cl-during neural development becomes a new optogenetic target.

molecular biology↗

bioRxiv2017

Excitatory Motor Neurons Function As Central Pattern Generators In An Anatomically Compressed Motor Circuit For Reverse Locomotion

Central pattern generators are cell- or network-driven oscillators that underlie motor rhythmicity. The existence and identity of C. elegans CPGs are unknown. Through cell ablation, electrophysiology, and calcium imaging, we identified oscillators for C. elegans reverse locomotion. We show that the cholinergic and excitatory class A motor neurons exhibit intrinsic and oscillatory activity, and such an activity can drive reverse locomotion without premotor interneurons. Regulation of their oscillatory activity, either through effecting the P/Q/N high voltage-activated calcium channel, an endogenous constituent of their intrinsic oscillation, or, via the dual regulation by descending premotor interneurons, determines the propensity, velocity, and sustention of reverse locomotion. Thus, the reversal motor neuron themselves serve as distributed local oscillators; regulation of their intrinsic activity controls the reversal motor state. These findings exemplify anatomic and functional compression: motor executors integrate the role of rhythm generation in a locomotor network that is constrained by small cell numbers.\n\nHighlightsO_LIThe class A motor neurons (A-MNs) intrinsically oscillate.\nC_LIO_LIHigh voltage-activated calcium channel is a constituent of A-MN oscillation.\nC_LIO_LIRegulation of A-MN oscillation by interneurons determines the reversal state.\nC_LIO_LIA-MNs integrate the role of multiple neuron types in large locomotor networks.\nC_LI

neuroscience↗

bioRxiv2017

Gene expression profiling reveals U1 snRNA regulates cancer gene expression

U1 small nuclear RNA (U1 snRNA), as one of the most abundant noncoding RNA in eukaryotic cells plays an important role in splicing of pre-mRNAs. Compared to other studies which have focused on the primary function of U1 snRNA and the neurodegenerative diseases caused by the abnormalities of U1 snRNA, this study is to investigate how the U1 snRNA over-expression affects the expression of genes on a genome-wide scale. In this study, we built a model of U1 snRNA over-expression in a rat cell line. By comparing the gene expression profiles of U1 snRNA over-expressed cells with those of their controls using the microarray experiments, 916 genes or loci were identified significantly differentially expressed. These 595 up-regulated genes and 321 down-regulated genes were further analyzed using the annotations from the GO terms and the KEGG database. As a result, three of 12 enriched pathways are well-known cancer pathways, while nine of them were associated to cancers in previous studies. The further analysis of 73 genes involved in 12 pathways suggests that U1 snRNA regulates cancer gene expression. The microarray data with ID GSE84304 is available in the NCBI GEO database.

cancer biology↗