Biology subjects

Chen, Z.

Publications and source records attributed to Chen, Z..

967 records · Page 54Linked to original sources

bioRxiv2017

Legionella protection and vaccination mediated by Mucosal Associated Invariant T (MAIT) cells

Mucosal associated invariant T (MAIT) cells recognize conserved microbial metabolites from riboflavin synthesis. Striking evolutionary conservation and pulmonary abundance implicate them in antibacterial host defense, yet their roles in protection against clinically significant pathogens are unknown. Murine Legionella infection induced MR1-dependent MAIT cell activation and rapid pulmonary accumulation of MAIT cells associated with immune protection detectable in fully immunocompetent host animals. MAIT cell protection was more evident in mice lacking CD4+ cells, whilst profoundly immunodeficient RAG2-/-{gamma}C-/- mice were substantially rescued from uniformly lethal Legionella infection by adoptively-transferred MAIT cells. This protection was dependent on MR1, IFN-{gamma} and GM-CSF, but not IL-17, TNF- or perforin. Protection was enhanced and observed earlier post-infection in mice that were Ag-primed to boost MAIT cells before infection. Our findings define a significant role for MAIT cells in protection against a major human pathogen and indicate a potential role for vaccination to enhance MAIT cell immunity.

immunology↗

bioRxiv2017

The Activation of MEK1 by Enhanced Homodimerization Drives Tumorigenesis

Hyperactive RAS/RAF/MEK/ERK signaling has a well-defined role in cancer biology. Aberrant pathway activation occurs mostly upstream of MEK; however, MEK mutations are prevalent in some cancer subsets. Here we show that cancer-related MEK mutants can be classified as those activated by relieving the inhibitory role of helix A, and those with in-frame deletions of {beta}3-C loop, which exhibit differential resistance to MEK inhibitors in vitro and in vivo. The {beta}3-C loop deletions activate MEK1 through enhancing homodimerization that can drive intradimer cross-phosphorylation of activation loop. Further, we demonstrate that MEK1 dimerization is required both for its activation by RAF and for its catalytic activity towards ERK. Our study identifies a novel group of MEK mutants, illustrates some key steps in RAF/MEK/ERK activation, and has important implications for the design of therapies targeting hyperactive RAS/RAF/MEK/ERK signaling in cancers.

cancer biology↗

bioRxiv2017

T helper cells modulate intestinal stem cell renewal and differentiation

In the small intestine, a cellular niche of diverse accessory cell types supports the rapid generation of mature epithelial cell types through self-renewal, proliferation, and differentiation of intestinal stem cells (ISCs). However, not much is known about interactions between immune cells and ISCs, and it is unclear if and how immune cell dynamics affect eventual ISC fate or the balance between self-renewal and differentiation. Here, we used single-cell RNA-seq (scRNA-Seq) of intestinal epithelial cells (IECs) to identify new mechanisms for ISC-immune cell interactions. Surprisingly, MHC class II (MHCII) is enriched in two distinct subsets of Lgr5+ crypt base columnar ISCs, which are also distinguished by higher proliferation rates. Using co-culture of T cells with intestinal organoids, cytokine stimulations, and in vivo mouse models, we confirm that CD4+ T helper (Th) cells communicate with ISCs and affect their differentiation, in a manner specific to the Th subtypes and their signature cytokines and dependent on MHCII expression by ISCs. Specific inducible knockout of MHCII in intestinal epithelial cells in mice in vivo results in expansion of the ISC pool. Mice lacking T cells have expanded ISC pools, whereas specific depletion of Treg cells in vivo results in substantial reduction of ISC numbers. Our findings show that interactions between Th cells and ISCs mediated via MHCII expressed in intestinal epithelial stem cells help orchestrate tissue-wide responses to external signals.

immunology↗

bioRxiv2017

Force dependence of filopodia adhesion: involvement of myosin II and formins

Filopodia are dynamic membrane protrusions driven by polymerization of an actin filament core, mediated by formin molecules at the filopodia tips. Filopodia can adhere to the extracellular matrix and experience both external and cell generated pulling forces. The role of such forces in filopodia adhesion is however insufficiently understood. Here, we induced sustained growth of filopodia by applying pulling force to their tips via attached fibronectin-coated beads trapped by optical tweezers. Strikingly, pharmacological inhibition or knockdown of myosin IIA, which localized to the base of filopodia, resulted in weakening of filopodia adherence strength. Inhibition of formins, which caused detachment of actin filaments from formin molecules, produced similar effect. Thus, myosin IIA-generated centripetal force transmitted to the filopodia tips through interactions between formins and actin filaments are required for filopodia adhesion. Force-dependent adhesion led to preferential attachment of filopodia to rigid versus fluid substrates, which may underlie cell orientation and polarization.

cell biology↗

bioRxiv2017

Architecture of mammalian centriole distal appendages accommodates distinct blade and matrix functional elements

Distal appendages (DAPs) are nanoscale, pinwheel-like structures protruding from the distal end of the centriole that mediate membrane docking during ciliogenesis, marking the cilia base around the ciliary gate. Here, we determined a superresolved multiplex of 16 centriole-distal-end components. Surprisingly, rather than pinwheels, intact DAPs exhibit a cone-shaped architecture with components filling the space between each pinwheel blade, a new structural element we termed the distal appendage matrix (DAM). Specifically, CEP83, CEP89, SCLT1, and CEP164 form the backbone of pinwheel blades, with CEP83 confined at the root and CEP164 extending to the tip near the membrane-docking site. By contrast, FBF1 marks the distal end of the DAM near the ciliary membrane. Strikingly, unlike CEP164 which is essential for ciliogenesis, FBF1 is required for ciliary gating of transmembrane proteins, revealing DAPs as an essential component of the ciliary gate. Our findings redefine both the structure and function of DAPs.

cell biology↗

bioRxiv2017

Complemented palindrome small RNAs first discovered from SARS coronavirus

In this study, we reported for the first time the existence of complemented palindrome small RNAs (cpsRNAs) and proposed cpsRNAs and palindrome small RNAs (psRNAs) as a novel class of small RNAs. The first discovered cpsRNA UCUUUAACAAGCUUGUUAAAGA from SARS coronavirus named SARS-CoV-cpsR-22 contained 22 nucleotides perfectly matching its reverse complementary sequence. Further sequence analysis supported that SARS-CoV-cpsR-22 originated from bat betacoronavirus. The results of RNAi experiments showed that one 19-nt segment of SARS-CoV-cpsR-22 significantly induced cell apoptosis. These results suggested that SARS-CoV-cpsR-22 could play a role in SARS-CoV infection or pathogenicity. The discovery of psRNAs and cpsRNAs paved the way to find new markers for pathogen detection and reveal the mechanisms in the infection or pathogenicity from a different point of view. The discovery of psRNAs and cpsRNAs also broaden the understanding of palindrome motifs in animal of plant genomes.

genomics↗

bioRxiv2017

Gene co-expression networks in whole blood implicate multiple interrelated molecular pathways in obese asthma

BackgroundAsthmatic children who develop obesity have poorer outcomes compared to those that do not, including poorer control, more severe symptoms, and greater resistance to standard treatment. Gene expression networks are powerful statistical tools for characterizing the underpinnings of human disease that leverage the putative co-regulatory relationships of genes to infer biological pathways altered in disease states.\n\nObjectiveThe aim of this study was to characterize the biology of childhood asthma complicated by adult obesity.\n\nMethodsWe performed weighted gene co-expression network analysis (WGCNA) of gene expression data in whole blood from 514 adult subjects from the Childhood Asthma Management Program (CAMP). We then performed module preservation and association replication analyses in 418 subjects from two independent asthma cohorts (one pediatric and one adult).\n\nResultsWe identified a multivariate model in which four gene co-expression network modules were associated with incident obesity in CAMP (each P < 0.05). The module memberships were enriched for genes in pathways related to platelets, integrins, extracellular matrix, smooth muscle, NF-{kappa}B signaling, and Hedgehog signaling. The network structures of each of the four obese asthma modules were significantly preserved in both replication cohorts (permutation P = 9.999E-05). The corresponding module gene sets were significantly enriched for differential expression in obese subjects in both replication cohorts (each P < 0.05).\n\nConclusionsOur gene co-expression network profiles thus implicate multiple interrelated pathways in the biology of an important endotype of obese asthma.\n\nKey MessagesO_LIWe hypothesized that individuals with asthma complicated by obesity had distinct blood gene expression signatures.\nC_LIO_LIGene co-expression network analysis implicated several inflammatory biological pathways in one form of obese asthma.\nC_LI\n\nCapsule SummaryThis work addresses a knowledge gap about the molecular relationship between asthma and obesity, suggesting that an endotype of obese asthma, known as asthma complicated by obesity, is underpinned by coherent biological mechanisms.\n\nAbbreviations

genomics↗

bioRxiv2017

Genome-wide association study of habitual physical activity in over 277,000 UK Biobank participants identifies novel variants and genetic correlations with chronotype and obesity-related traits.

Background/ObjectivesPhysical activity (PA) protects against a wide range of diseases. Engagement in habitual PA has been shown to be heritable, motivating the search for specific genetic variants that may ultimately inform efforts to promote PA and target the best type of PA for each individual.\n\nSubjects/MethodsWe used data from the UK Biobank to perform the largest genome-wide association study of PA to date, using three measures based on self-report (n=277,656) and two measures based on wrist-worn accelerometry data (n=67,808). We examined genetic correlations of PA with other traits and diseases, as well as tissue-specific gene expression patterns. With data from the Atherosclerosis Risk in Communities (ARIC; n=8,556) study, we performed a meta-analysis of our top hits for moderate-to-vigorous PA (MVPA).\n\nResultsWe identified 26 genome-wide loci across the five PA measures examined. Upon meta-analysis of the top hits for MVPA with results from the ARIC study, 8 of 10 remained significant at p<5x10-8. Interestingly, among these, the rs429358 variant in the APOE gene was the most strongly associated with MVPA. Variants in CADM2, a gene recently implicated in risk-taking behavior and other personality and cognitive traits, were found to be associated with regular engagement in strenuous sports or other exercises. We also identified thirteen loci consistently associated (p<0.005) with each of the five PA measures. We find genetic correlations of PA with educational attainment traits, chronotype, psychiatric traits, and obesity-related traits. Tissue enrichment analyses implicate the brain and pituitary gland as locations where PA-associated loci may exert their actions.\n\nConclusionsThese results provide new insight into the genetic basis of habitual PA, and the genetic links connecting PA with other traits and diseases.

genetics↗

bioRxiv2017

Multimodal Surface Matching with Higher-Order Smoothness Constraints

The accurate alignment of brains is fundamental to the statistical sensitivity and spatial localisation of group studies in brain imaging, and cortical surface-based alignment is generally accepted to be superior to volume-based approaches at aligning cortical areas. However, human subjects have considerable variation in cortical folding, and in the location of cortical areas relative to these folds, which makes aligning cortical areas based on folding alone a challenging problem. The Multimodal Surface Matching (MSM) tool is a flexible spherical registration approach that enables accurate registration of surfaces based on a variety of different features. Using MSM, we have previously shown that using areal features such as resting state-networks and myelin maps to drive cross-subject surface alignment improves group task fMRI statistics and map sharpness. However, the initial implementation of MSMs regularisation function did not penalize all forms of surface distortion evenly. In some cases, this allowed peak distortions to exceed neurobiologically plausible limits unless the regularisation strength was increased, in which case this prevented the algorithm from fully maximizing surface alignment. Here, we propose a new regularisation penalty, derived from physically relevant equations of strain (deformation) energy, and demonstrate that its use leads to improved and more robust alignment of multi-modal imaging data. In addition, since spherical warps incorporate projection distortions that are unavoidable when mapping from a convoluted cortical surface to the sphere, we also propose constraints to enforce smooth deformation of cortical anatomies. We test the impact of this approach for longitudinal modeling of cortical development for neonates (born between 32 and 45 weeks) and demonstrate that the proposed method increases the biological interpretability of the distortion fields and improves the statistical significance of population-based analysis relative to other spherical methods.

neuroscience↗

bioRxiv2017

Modeling Zika Virus Congenital Eye Disease: Differential Susceptibility of Fetal Retinal Progenitor Cells and iPSC-Derived Retinal Stem Cells to Zika Virus Infection

Zika virus (ZIKV) causes microcephaly and congenital eye disease that is characterized by macular pigment mottling, macular atrophy, and loss of foveal reflex. The cell and molecular basis of congenital ZIKV infection are not well understood. Here, we utilized a biologically relevant cell-based system on human fetal retinal pigment epithelial cells (FRPE) and iPSC-derived retinal stem cells (iRSCs) to model ZIKV-ocular cell injury processes. FRPEs were highly susceptible to ZIKV, resulting in apoptosis and decreased viability, whereas iRSCs showed reduced susceptibility. Transcriptomics and proteomics analyses of infected FRPE cells revealed the activation of innate immune and inflammatory response genes, and dysregulation of cell survival pathways, mitochondrial transmembrane potential, phagocytosis, and particle internalization. Nucleoside analogue drug treatment inhibited ZIKV replication and prevented apoptosis. In conclusion, ZIKV affects ocular cells of different developmental stages resulting in cellular injury and death, further providing molecular insight into the pathogenesis of congenital eye disease.

microbiology↗

bioRxiv2017

LncRNA-TUG1/EZH2 Axis Promotes Cell Proliferation, Migration And The EMT Phenotype Formation Through Sponging miR-382

Pancreatic carcinoma (PC) is the one of the most common and malignant cancer in the world. Despite many effort have been made in recent years, the survival rate of PC still remains unsatisfied. Therefore, investigating the mechanisms underlying the progression of PC might facilitate the development of novel treatments that improve patient prognosis. LncRNA Taurine Up-regulated Gene 1 (TUG1) was initially identified as a transcript up - regulated by taurine, siRNA - based depletion of TUG1 suppresses mouse retinal development, and the abnormal expression of TUG1 has been reported in many cancers. However, the biological role and molecular mechanism of TUG1 in pancreatic carcinoma (PC) still needs to be further investigated. In the current study, the expression of TUG1 in the PC cell lines and tissues was measured by quantitative real-time PCR (qRT-PCR), and loss-of-function and gain-of-function approaches were applied to investigate the function of TUG1 in PC cell. Online database analysis tools showed that miR-382 could interact with TUG1 and we found an inverse correlation between TUG1 and miR-382 in PC specimens. Moreover, dual luciferase reporter assay, RNA-binding protein immunoprecipitation (RIP) and applied biotin-avidin pulldown system further provide evidence that TUG1 directly targeted miR-382 by binding with microRNA binding site harboring in the TUG1 sequence. Furthermore, gene expression array analysis using clinical samples and RT-qPCR proposed that EZH2 was a target of miR-382 in PC. Collectively, these findings revealed that TUG1 functions as an oncogenic lncRNA that promotes tumor progression at least partially through function as an endogenous sponge by competing for miR-382 binding to regulate the miRNA target EZH2.

cancer biology↗

bioRxiv2017

PGC-1α coordinates with Bcl-2 to control cell cycle in U251 cells through reducing ROS

B-cell lymphoma 2 (Bcl-2) has a dual function, acting both as an oncogene and an anti-tumor gene. It is well known that Bcl-2 exerts its tumor promoting function through the mitochondrial pathway. However, the mechanism by which Bcl-2 suppresses tumor formation is not well understood. We have previously shown that Bcl-2 inhibits cell cycle progression from the G0/G1 to the S phase after serum starvation, and that quiescent Bcl-2 expressing cells maintained a significant lower level of mitochondrial reactive oxygen species (ROS) than the control cells. Based on the fact that ROS mediate cell cycle progression, and are controlled by peroxisome proliferator-activated receptor-{gamma} co-activator 1 (PGC-1), a key molecule induced by prolonged starvation and involved in mitochondrial metabolism, we hypothesized that PGC-1 might be related with the cell cycle function of Bcl-2. Here, we showed that PGC-1 was upregulated upon Bcl-2 overexpression and downregulated following Bcl-2 knockdown during serum starvation. Knockdown of PGC-1 activated Bcl-2 expression. Taken together, our results suggest that after serum depletion, PGC-la might coordinate with Bcl-2 to reduce ROS, which in turn delay cell cycle progression.\n\nSummary statementPGC-1 coordinate with Bcl-2 delay cell cycle progression to reduce ROS after serum depletion in human glioma U251 cells.

biochemistry↗

bioRxiv2016

Highly-efficient Cpf1-mediated gene targeting in mice following high concentration pronuclear injection

Cpf1 has emerged as an alternative to the Cas9 RNA-guided nuclease. Here we show that gene targeting rates in mice using Cpf1 can meet or even surpass Cas9 targeting rates (approaching 100% targeting) but require higher concentrations of mRNA and guide. We also demonstrate that co-injecting two guides with close targeting sites can result in synergistic genomic cutting, even if one of the guides has minimal cutting activity.

genetics↗